Incidental Mutation 'R4772:Srrm1'
ID367594
Institutional Source Beutler Lab
Gene Symbol Srrm1
Ensembl Gene ENSMUSG00000028809
Gene Nameserine/arginine repetitive matrix 1
SynonymsSRm160
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location135320484-135353321 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 135342379 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030613] [ENSMUST00000084846] [ENSMUST00000105861] [ENSMUST00000131373] [ENSMUST00000136342] [ENSMUST00000136409]
Predicted Effect unknown
Transcript: ENSMUST00000030613
AA Change: T239I
SMART Domains Protein: ENSMUSP00000030613
Gene: ENSMUSG00000028809
AA Change: T239I

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 4.31e-5 PROSPERO
internal_repeat_1 427 456 3.46e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 3.46e-6 PROSPERO
internal_repeat_3 670 693 4.31e-5 PROSPERO
internal_repeat_4 684 698 4.31e-5 PROSPERO
internal_repeat_2 689 734 4.31e-5 PROSPERO
internal_repeat_3 719 740 4.31e-5 PROSPERO
internal_repeat_5 730 740 8.09e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 4.31e-5 PROSPERO
internal_repeat_5 808 818 8.09e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 886 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000084846
AA Change: T239I
SMART Domains Protein: ENSMUSP00000081906
Gene: ENSMUSG00000028809
AA Change: T239I

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 402 N/A INTRINSIC
internal_repeat_2 404 450 3.57e-5 PROSPERO
internal_repeat_1 422 451 2.79e-6 PROSPERO
low complexity region 471 495 N/A INTRINSIC
low complexity region 512 529 N/A INTRINSIC
low complexity region 550 656 N/A INTRINSIC
internal_repeat_1 661 695 2.79e-6 PROSPERO
internal_repeat_3 665 688 3.57e-5 PROSPERO
internal_repeat_4 679 693 3.57e-5 PROSPERO
internal_repeat_2 684 729 3.57e-5 PROSPERO
internal_repeat_3 714 735 3.57e-5 PROSPERO
internal_repeat_5 725 735 6.75e-5 PROSPERO
low complexity region 741 790 N/A INTRINSIC
internal_repeat_4 794 808 3.57e-5 PROSPERO
internal_repeat_5 803 813 6.75e-5 PROSPERO
low complexity region 822 846 N/A INTRINSIC
low complexity region 849 886 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105861
AA Change: T239I
SMART Domains Protein: ENSMUSP00000101487
Gene: ENSMUSG00000028809
AA Change: T239I

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 1.99e-5 PROSPERO
internal_repeat_1 427 456 1.45e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 539 647 N/A INTRINSIC
internal_repeat_1 652 686 1.45e-6 PROSPERO
internal_repeat_3 656 679 1.99e-5 PROSPERO
internal_repeat_4 670 684 1.99e-5 PROSPERO
internal_repeat_2 675 720 1.99e-5 PROSPERO
internal_repeat_3 705 726 1.99e-5 PROSPERO
internal_repeat_5 716 726 3.82e-5 PROSPERO
low complexity region 732 781 N/A INTRINSIC
internal_repeat_4 785 799 1.99e-5 PROSPERO
internal_repeat_5 794 804 3.82e-5 PROSPERO
low complexity region 813 837 N/A INTRINSIC
low complexity region 840 877 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131301
AA Change: T28I
SMART Domains Protein: ENSMUSP00000125477
Gene: ENSMUSG00000028809
AA Change: T28I

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 38 61 N/A INTRINSIC
low complexity region 63 135 N/A INTRINSIC
internal_repeat_1 182 196 7.32e-5 PROSPERO
internal_repeat_1 195 209 7.32e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000131373
SMART Domains Protein: ENSMUSP00000122754
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 145 197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134854
Predicted Effect unknown
Transcript: ENSMUST00000136342
AA Change: T239I
SMART Domains Protein: ENSMUSP00000125003
Gene: ENSMUSG00000028809
AA Change: T239I

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
PWI 40 115 2.25e-42 SMART
low complexity region 124 141 N/A INTRINSIC
low complexity region 148 227 N/A INTRINSIC
low complexity region 248 407 N/A INTRINSIC
internal_repeat_2 409 455 3.36e-5 PROSPERO
internal_repeat_1 427 456 2.61e-6 PROSPERO
low complexity region 476 500 N/A INTRINSIC
low complexity region 517 534 N/A INTRINSIC
low complexity region 555 661 N/A INTRINSIC
internal_repeat_1 666 700 2.61e-6 PROSPERO
internal_repeat_3 670 693 3.36e-5 PROSPERO
internal_repeat_4 684 698 3.36e-5 PROSPERO
internal_repeat_2 689 734 3.36e-5 PROSPERO
internal_repeat_3 719 740 3.36e-5 PROSPERO
internal_repeat_5 730 740 6.37e-5 PROSPERO
low complexity region 746 795 N/A INTRINSIC
internal_repeat_4 799 813 3.36e-5 PROSPERO
internal_repeat_5 808 818 6.37e-5 PROSPERO
low complexity region 827 851 N/A INTRINSIC
low complexity region 854 891 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136409
SMART Domains Protein: ENSMUSP00000124450
Gene: ENSMUSG00000028809

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:PWI 38 95 4.4e-17 PFAM
low complexity region 119 131 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154788
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Srrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02063:Srrm1 APN 4 135347207 splice site probably null
IGL02070:Srrm1 APN 4 135325104 missense unknown
IGL02073:Srrm1 APN 4 135325104 missense unknown
IGL02193:Srrm1 APN 4 135325104 missense unknown
IGL02232:Srrm1 APN 4 135353116 start codon destroyed probably null 1.00
IGL02377:Srrm1 APN 4 135325104 missense unknown
IGL02379:Srrm1 APN 4 135325104 missense unknown
IGL02380:Srrm1 APN 4 135325104 missense unknown
IGL02382:Srrm1 APN 4 135325104 missense unknown
IGL02386:Srrm1 APN 4 135325104 missense unknown
IGL02387:Srrm1 APN 4 135325104 missense unknown
IGL02393:Srrm1 APN 4 135321414 unclassified probably benign
IGL02436:Srrm1 APN 4 135325104 missense unknown
IGL02438:Srrm1 APN 4 135325104 missense unknown
IGL02439:Srrm1 APN 4 135325104 missense unknown
IGL02440:Srrm1 APN 4 135325104 missense unknown
IGL02500:Srrm1 APN 4 135325104 missense unknown
IGL02561:Srrm1 APN 4 135325104 missense unknown
IGL02562:Srrm1 APN 4 135325104 missense unknown
IGL02566:Srrm1 APN 4 135325104 missense unknown
IGL02567:Srrm1 APN 4 135325104 missense unknown
IGL02568:Srrm1 APN 4 135325104 missense unknown
IGL02569:Srrm1 APN 4 135325104 missense unknown
IGL02570:Srrm1 APN 4 135325104 missense unknown
IGL02572:Srrm1 APN 4 135325104 missense unknown
IGL02583:Srrm1 APN 4 135325104 missense unknown
IGL02584:Srrm1 APN 4 135325104 missense unknown
IGL02585:Srrm1 APN 4 135325104 missense unknown
IGL02586:Srrm1 APN 4 135325104 missense unknown
IGL02587:Srrm1 APN 4 135325104 missense unknown
IGL02588:Srrm1 APN 4 135325104 missense unknown
IGL02589:Srrm1 APN 4 135325104 missense unknown
IGL02596:Srrm1 APN 4 135325104 missense unknown
IGL02597:Srrm1 APN 4 135325104 missense unknown
IGL02601:Srrm1 APN 4 135325104 missense unknown
IGL02602:Srrm1 APN 4 135325104 missense unknown
IGL02609:Srrm1 APN 4 135325104 missense unknown
IGL02614:Srrm1 APN 4 135325104 missense unknown
IGL02631:Srrm1 APN 4 135325104 missense unknown
IGL02632:Srrm1 APN 4 135325104 missense unknown
IGL02657:Srrm1 APN 4 135325104 missense unknown
IGL02658:Srrm1 APN 4 135325104 missense unknown
IGL02659:Srrm1 APN 4 135325104 missense unknown
IGL02660:Srrm1 APN 4 135325104 missense unknown
IGL02677:Srrm1 APN 4 135325104 missense unknown
IGL02683:Srrm1 APN 4 135325104 missense unknown
IGL02686:Srrm1 APN 4 135325104 missense unknown
IGL02690:Srrm1 APN 4 135325104 missense unknown
IGL02713:Srrm1 APN 4 135325104 missense unknown
IGL02723:Srrm1 APN 4 135325104 missense unknown
IGL02724:Srrm1 APN 4 135325104 missense unknown
IGL02725:Srrm1 APN 4 135325104 missense unknown
IGL02730:Srrm1 APN 4 135325104 missense unknown
IGL02731:Srrm1 APN 4 135325104 missense unknown
IGL02732:Srrm1 APN 4 135325104 missense unknown
IGL02733:Srrm1 APN 4 135325104 missense unknown
IGL02734:Srrm1 APN 4 135325104 missense unknown
IGL02743:Srrm1 APN 4 135325104 missense unknown
IGL02744:Srrm1 APN 4 135325104 missense unknown
IGL02752:Srrm1 APN 4 135325104 missense unknown
Serious UTSW 4 135340926 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0131:Srrm1 UTSW 4 135340573 nonsense probably null
R0132:Srrm1 UTSW 4 135340573 nonsense probably null
R0510:Srrm1 UTSW 4 135338543 intron probably benign
R0691:Srrm1 UTSW 4 135324991 nonsense probably null
R1337:Srrm1 UTSW 4 135346733 critical splice donor site probably null
R1397:Srrm1 UTSW 4 135321431 unclassified probably benign
R2883:Srrm1 UTSW 4 135321411 unclassified probably benign
R4043:Srrm1 UTSW 4 135340931 unclassified probably benign
R4837:Srrm1 UTSW 4 135345512 intron probably benign
R4975:Srrm1 UTSW 4 135346720 splice site probably benign
R5401:Srrm1 UTSW 4 135324069 splice site probably benign
R6144:Srrm1 UTSW 4 135337873 unclassified probably benign
R6542:Srrm1 UTSW 4 135340926 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGAAACGATATGGCAGACAG -3'
(R):5'- GAAGACGATCTTCCCCTGTCAG -3'

Sequencing Primer
(F):5'- ACAGGTGGTCATCTCTGGG -3'
(R):5'- ATCTTCCCCTGTCAGGAGAGAGAG -3'
Posted On2015-12-29