Incidental Mutation 'R4772:Zcchc4'
ID367596
Institutional Source Beutler Lab
Gene Symbol Zcchc4
Ensembl Gene ENSMUSG00000029179
Gene Namezinc finger, CCHC domain containing 4
Synonyms4930449I23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location52775409-52824665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52796207 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 186 (L186P)
Ref Sequence ENSEMBL: ENSMUSP00000109537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031077] [ENSMUST00000113904]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031077
AA Change: L186P

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031077
Gene: ENSMUSG00000029179
AA Change: L186P

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.9e-19 PFAM
Pfam:N6-adenineMlase 168 337 5.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113901
SMART Domains Protein: ENSMUSP00000109534
Gene: ENSMUSG00000029179

DomainStartEndE-ValueType
ZnF_C2HC 226 242 1.27e-2 SMART
low complexity region 248 266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113904
AA Change: L186P

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109537
Gene: ENSMUSG00000029179
AA Change: L186P

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.4e-17 PFAM
Pfam:N6-adenineMlase 168 338 7.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
low complexity region 464 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149612
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198465
Predicted Effect probably benign
Transcript: ENSMUST00000199840
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Zcchc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc4 APN 5 52816169 missense probably benign 0.05
IGL00953:Zcchc4 APN 5 52808296 missense probably damaging 1.00
IGL01860:Zcchc4 APN 5 52808356 missense probably damaging 1.00
IGL02248:Zcchc4 APN 5 52796076 missense probably damaging 1.00
IGL02536:Zcchc4 APN 5 52808316 missense probably damaging 1.00
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0573:Zcchc4 UTSW 5 52795979 missense probably damaging 1.00
R0634:Zcchc4 UTSW 5 52783208 missense probably benign 0.15
R1353:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R1791:Zcchc4 UTSW 5 52796590 missense probably damaging 1.00
R1854:Zcchc4 UTSW 5 52815826 missense probably damaging 1.00
R2108:Zcchc4 UTSW 5 52796132 missense probably damaging 0.99
R2696:Zcchc4 UTSW 5 52796231 missense probably damaging 1.00
R2991:Zcchc4 UTSW 5 52804438 missense probably damaging 1.00
R3894:Zcchc4 UTSW 5 52784100 missense probably damaging 1.00
R4523:Zcchc4 UTSW 5 52784067 missense probably damaging 1.00
R4672:Zcchc4 UTSW 5 52796605 missense probably benign 0.00
R4905:Zcchc4 UTSW 5 52796650 missense probably damaging 1.00
R4954:Zcchc4 UTSW 5 52819217 missense probably damaging 1.00
R5093:Zcchc4 UTSW 5 52796610 missense probably benign 0.38
R5371:Zcchc4 UTSW 5 52785170 missense probably benign 0.19
R5401:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R5755:Zcchc4 UTSW 5 52816169 missense probably benign 0.00
R6110:Zcchc4 UTSW 5 52796144 missense possibly damaging 0.95
R6244:Zcchc4 UTSW 5 52783161 missense probably benign 0.00
R6465:Zcchc4 UTSW 5 52819276 missense probably benign 0.03
R6906:Zcchc4 UTSW 5 52823634 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGCTGTTACCTGCAGACTG -3'
(R):5'- TGCAGAGAATCTGGCTCACC -3'

Sequencing Primer
(F):5'- CTGCAGACTGGAGGGAGCAC -3'
(R):5'- GAATCTGGCTCACCTTAGTTTTACAG -3'
Posted On2015-12-29