Incidental Mutation 'R4772:Nlrp14'
ID367606
Institutional Source Beutler Lab
Gene Symbol Nlrp14
Ensembl Gene ENSMUSG00000016626
Gene NameNLR family, pyrin domain containing 14
Synonyms4921520L01Rik, GC-LRR, Nalp-iota, Nalp14
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location107166990-107198102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107181186 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 5 (D5G)
Ref Sequence ENSEMBL: ENSMUSP00000081819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084763]
Predicted Effect probably benign
Transcript: ENSMUST00000084763
AA Change: D5G

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081819
Gene: ENSMUSG00000016626
AA Change: D5G

DomainStartEndE-ValueType
Pfam:NACHT 81 249 1.6e-38 PFAM
Blast:LRR 574 601 4e-6 BLAST
LRR 629 656 1.67e0 SMART
LRR 658 685 1.56e0 SMART
LRR 686 713 2.05e-2 SMART
LRR 715 742 7.9e-4 SMART
LRR 743 770 1.25e-1 SMART
LRR 772 799 4.68e-1 SMART
LRR 800 827 9.08e-4 SMART
LRR 829 856 1.59e1 SMART
LRR 857 884 7.15e-1 SMART
LRR 886 913 6.57e0 SMART
LRR 914 941 3.36e1 SMART
low complexity region 953 963 N/A INTRINSIC
Meta Mutation Damage Score 0.012 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Nlrp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Nlrp14 APN 7 107192502 missense possibly damaging 0.91
IGL00337:Nlrp14 APN 7 107182101 missense possibly damaging 0.95
IGL00587:Nlrp14 APN 7 107181767 missense probably benign 0.10
IGL00654:Nlrp14 APN 7 107196144 missense probably damaging 1.00
IGL00712:Nlrp14 APN 7 107197241 missense probably damaging 1.00
IGL00765:Nlrp14 APN 7 107190139 missense possibly damaging 0.85
IGL01392:Nlrp14 APN 7 107197913 utr 3 prime probably benign
IGL02325:Nlrp14 APN 7 107182316 missense possibly damaging 0.95
IGL02572:Nlrp14 APN 7 107182722 nonsense probably null
IGL03180:Nlrp14 APN 7 107182626 missense probably benign 0.01
IGL03186:Nlrp14 APN 7 107186670 missense probably damaging 0.98
PIT4403001:Nlrp14 UTSW 7 107184892 missense possibly damaging 0.65
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0148:Nlrp14 UTSW 7 107182721 missense probably benign
R0720:Nlrp14 UTSW 7 107182013 missense probably benign 0.19
R0842:Nlrp14 UTSW 7 107183135 missense probably benign 0.08
R1367:Nlrp14 UTSW 7 107182811 missense probably benign 0.01
R1472:Nlrp14 UTSW 7 107182703 missense probably benign 0.33
R1483:Nlrp14 UTSW 7 107190122 missense possibly damaging 0.84
R1615:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
R1991:Nlrp14 UTSW 7 107196200 missense probably benign 0.21
R2171:Nlrp14 UTSW 7 107182502 missense probably damaging 0.99
R2287:Nlrp14 UTSW 7 107182662 missense probably damaging 1.00
R2394:Nlrp14 UTSW 7 107197824 missense probably benign 0.13
R3151:Nlrp14 UTSW 7 107182552 missense probably benign 0.32
R3732:Nlrp14 UTSW 7 107182367 missense probably benign 0.00
R3793:Nlrp14 UTSW 7 107182274 missense probably benign 0.00
R4368:Nlrp14 UTSW 7 107197805 missense probably benign 0.01
R4652:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R4886:Nlrp14 UTSW 7 107182655 missense probably benign 0.02
R4896:Nlrp14 UTSW 7 107197179 frame shift probably null
R4910:Nlrp14 UTSW 7 107186583 missense possibly damaging 0.93
R5925:Nlrp14 UTSW 7 107186653 missense probably benign 0.35
R5997:Nlrp14 UTSW 7 107182496 missense probably benign 0.11
R6192:Nlrp14 UTSW 7 107182439 missense probably benign 0.00
R6230:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R6799:Nlrp14 UTSW 7 107196139 missense probably benign 0.37
R7116:Nlrp14 UTSW 7 107183048 missense possibly damaging 0.86
R7131:Nlrp14 UTSW 7 107184814 missense possibly damaging 0.47
R7387:Nlrp14 UTSW 7 107183107 missense probably damaging 0.98
X0019:Nlrp14 UTSW 7 107182927 missense probably benign 0.11
X0050:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
Z1088:Nlrp14 UTSW 7 107186622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTGGCTCTAAACCCACA -3'
(R):5'- TCCAGTTCTATTGACTTTGAATGACTG -3'

Sequencing Primer
(F):5'- CATTCGTGAATCCAGAACACTTGGG -3'
(R):5'- CCTTAGAAACTAACCCTGC -3'
Posted On2015-12-29