Incidental Mutation 'R4772:Olfr503'
ID367607
Institutional Source Beutler Lab
Gene Symbol Olfr503
Ensembl Gene ENSMUSG00000060759
Gene Nameolfactory receptor 503
SynonymsGA_x6K02T2PBJ9-10874315-10875286, Olfr1548, MOR34-8P, MOR34-9, MOR34-9, MOR34-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4772 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108544527-108545498 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108544885 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 120 (M120K)
Ref Sequence ENSEMBL: ENSMUSP00000077296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078162] [ENSMUST00000211693]
Predicted Effect probably damaging
Transcript: ENSMUST00000078162
AA Change: M120K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077296
Gene: ENSMUSG00000060759
AA Change: M120K

DomainStartEndE-ValueType
Pfam:7tm_4 35 315 3e-103 PFAM
Pfam:7TM_GPCR_Srsx 39 268 2.4e-7 PFAM
Pfam:7tm_1 45 297 9.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211693
AA Change: M118K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Olfr503
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Olfr503 APN 7 108544726 nonsense probably null
IGL02031:Olfr503 APN 7 108544930 missense probably benign 0.03
IGL02426:Olfr503 APN 7 108544980 missense probably benign 0.01
IGL02502:Olfr503 APN 7 108544639 missense probably damaging 1.00
IGL03208:Olfr503 APN 7 108545119 missense probably benign 0.02
R0507:Olfr503 UTSW 7 108545085 missense probably damaging 0.98
R0967:Olfr503 UTSW 7 108544789 missense probably damaging 1.00
R1181:Olfr503 UTSW 7 108545302 missense probably benign 0.00
R1501:Olfr503 UTSW 7 108544575 missense probably benign
R1596:Olfr503 UTSW 7 108545083 missense possibly damaging 0.90
R1657:Olfr503 UTSW 7 108545377 missense possibly damaging 0.50
R1708:Olfr503 UTSW 7 108544574 missense probably benign 0.04
R2215:Olfr503 UTSW 7 108544888 missense probably damaging 1.00
R4131:Olfr503 UTSW 7 108544537 nonsense probably null
R5009:Olfr503 UTSW 7 108544848 missense probably benign 0.01
R5297:Olfr503 UTSW 7 108545404 missense probably damaging 1.00
R5788:Olfr503 UTSW 7 108545344 missense probably damaging 0.97
R5944:Olfr503 UTSW 7 108545277 missense possibly damaging 0.90
R6522:Olfr503 UTSW 7 108544995 missense probably benign 0.09
R7045:Olfr503 UTSW 7 108545245 missense probably damaging 1.00
R7339:Olfr503 UTSW 7 108544900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGATGGGGAACTGTGGACTCC -3'
(R):5'- TGCCTCGAAAGTAGGGTAGG -3'

Sequencing Primer
(F):5'- TTGAGGATTCCTTACACAGACCCATG -3'
(R):5'- CCTCGAAAGTAGGGTAGGCACTTG -3'
Posted On2015-12-29