Incidental Mutation 'R4772:Lrrc49'
ID367612
Institutional Source Beutler Lab
Gene Symbol Lrrc49
Ensembl Gene ENSMUSG00000047766
Gene Nameleucine rich repeat containing 49
SynonymsD430025H09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.231) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location60568859-60688158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60685052 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 53 (N53S)
Ref Sequence ENSEMBL: ENSMUSP00000121491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065603] [ENSMUST00000114032] [ENSMUST00000114034] [ENSMUST00000132366] [ENSMUST00000150060] [ENSMUST00000166168]
Predicted Effect probably benign
Transcript: ENSMUST00000065603
AA Change: N59S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000070606
Gene: ENSMUSG00000047766
AA Change: N59S

DomainStartEndE-ValueType
LRR 199 221 2.84e1 SMART
LRR 243 264 1.49e1 SMART
LRR 265 286 1.37e2 SMART
LRR 287 308 1.62e1 SMART
LRR 309 332 6.77e0 SMART
low complexity region 378 394 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114032
AA Change: N53S

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109666
Gene: ENSMUSG00000047766
AA Change: N53S

DomainStartEndE-ValueType
LRR 127 149 2.84e1 SMART
LRR 171 192 1.49e1 SMART
LRR 193 214 1.37e2 SMART
LRR 215 236 1.62e1 SMART
LRR 237 260 6.77e0 SMART
low complexity region 306 322 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114034
AA Change: N59S

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109668
Gene: ENSMUSG00000047766
AA Change: N59S

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128877
Predicted Effect possibly damaging
Transcript: ENSMUST00000132366
AA Change: N53S

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000150060
AA Change: N59S

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118205
Gene: ENSMUSG00000047766
AA Change: N59S

DomainStartEndE-ValueType
LRR 133 155 2.84e1 SMART
LRR 177 198 1.49e1 SMART
LRR 199 220 1.37e2 SMART
LRR 221 242 1.62e1 SMART
LRR 243 266 6.77e0 SMART
low complexity region 312 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166168
AA Change: N53S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000128842
Gene: ENSMUSG00000047766
AA Change: N53S

DomainStartEndE-ValueType
LRR 193 215 2.84e1 SMART
LRR 237 258 1.49e1 SMART
LRR 259 280 1.37e2 SMART
LRR 281 302 1.62e1 SMART
LRR 303 326 6.77e0 SMART
low complexity region 372 388 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181046
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plekhg1 A T 10: 3,873,127 M32L probably benign Het
Plekhg1 A T 10: 3,873,130 T33S probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Lrrc49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lrrc49 APN 9 60601320 missense probably damaging 1.00
IGL00468:Lrrc49 APN 9 60687868 unclassified probably benign
IGL00792:Lrrc49 APN 9 60687838 missense probably damaging 0.97
IGL02252:Lrrc49 APN 9 60687859 start codon destroyed probably benign 0.04
IGL02830:Lrrc49 APN 9 60685110 missense probably damaging 1.00
IGL03103:Lrrc49 APN 9 60685033 critical splice donor site probably null
IGL03223:Lrrc49 APN 9 60687845 missense possibly damaging 0.72
IGL03244:Lrrc49 APN 9 60587857 missense probably damaging 1.00
IGL03392:Lrrc49 APN 9 60666280 splice site probably benign
IGL02837:Lrrc49 UTSW 9 60610322 missense probably benign 0.00
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0164:Lrrc49 UTSW 9 60680600 missense probably benign 0.26
R0335:Lrrc49 UTSW 9 60677095 missense probably damaging 0.99
R0399:Lrrc49 UTSW 9 60610246 splice site probably benign
R0607:Lrrc49 UTSW 9 60666357 missense probably benign 0.35
R1396:Lrrc49 UTSW 9 60680527 missense probably damaging 0.99
R1731:Lrrc49 UTSW 9 60621631 missense probably damaging 1.00
R1800:Lrrc49 UTSW 9 60598191 missense probably damaging 1.00
R1817:Lrrc49 UTSW 9 60602776 missense possibly damaging 0.94
R1876:Lrrc49 UTSW 9 60587777 missense possibly damaging 0.77
R1925:Lrrc49 UTSW 9 60649490 missense probably benign 0.07
R2172:Lrrc49 UTSW 9 60602682 missense probably benign 0.25
R2233:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2235:Lrrc49 UTSW 9 60598157 missense possibly damaging 0.57
R2927:Lrrc49 UTSW 9 60593746 nonsense probably null
R3955:Lrrc49 UTSW 9 60671359 missense probably damaging 1.00
R4214:Lrrc49 UTSW 9 60666326 missense probably benign 0.33
R5283:Lrrc49 UTSW 9 60687178 missense probably benign 0.06
R5801:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6115:Lrrc49 UTSW 9 60615161 missense possibly damaging 0.61
R6488:Lrrc49 UTSW 9 60602633 missense probably damaging 1.00
R6525:Lrrc49 UTSW 9 60598149 missense probably damaging 1.00
R6540:Lrrc49 UTSW 9 60685052 missense possibly damaging 0.93
R6550:Lrrc49 UTSW 9 60677147 missense probably benign 0.13
R6603:Lrrc49 UTSW 9 60593769 splice site probably null
R6878:Lrrc49 UTSW 9 60680148 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTGCTTTCAAACTAGAATAGGGG -3'
(R):5'- CTGATCTTGTGTAACTGCCTTTAATTG -3'

Sequencing Primer
(F):5'- GAAGCAATCCACTATGGTGTGTC -3'
(R):5'- TCCATGCACAGTGTTGCAAG -3'
Posted On2015-12-29