Incidental Mutation 'R4772:Plekhg1'
ID367616
Institutional Source Beutler Lab
Gene Symbol Plekhg1
Ensembl Gene ENSMUSG00000040624
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 1
SynonymsD10Ertd733e
Accession Numbers

Ncbi RefSeq: NM_001159942.1, NM_001033253.3; MGI:2676551

Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R4772 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location3740364-3967303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3873130 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 33 (T33S)
Ref Sequence ENSEMBL: ENSMUSP00000114056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042438] [ENSMUST00000120274]
Predicted Effect probably damaging
Transcript: ENSMUST00000042438
AA Change: T33S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040495
Gene: ENSMUSG00000040624
AA Change: T33S

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117631
Predicted Effect probably damaging
Transcript: ENSMUST00000120274
AA Change: T33S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114056
Gene: ENSMUSG00000040624
AA Change: T33S

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
RhoGEF 116 291 4.17e-52 SMART
PH 323 417 2.54e-6 SMART
low complexity region 419 431 N/A INTRINSIC
low complexity region 1151 1162 N/A INTRINSIC
low complexity region 1186 1197 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000136671
AA Change: T88S
SMART Domains Protein: ENSMUSP00000119950
Gene: ENSMUSG00000040624
AA Change: T88S

DomainStartEndE-ValueType
low complexity region 67 86 N/A INTRINSIC
RhoGEF 172 347 4.17e-52 SMART
PH 379 473 2.54e-6 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1242 1253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144543
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 95% (74/78)
Allele List at MGI

All alleles(13) : Targeted(2) Gene trapped(11)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,315,339 probably null Het
Adamts19 A G 18: 58,837,776 Q144R possibly damaging Het
Adgrb3 C A 1: 25,531,875 C507F probably damaging Het
Atg9b T C 5: 24,385,239 *923W probably null Het
Atp13a4 T C 16: 29,420,835 probably benign Het
Baz2b G T 2: 59,958,451 R697S probably damaging Het
Bicdl1 A G 5: 115,661,478 I184T probably benign Het
Bpifb4 C T 2: 153,942,983 L204F possibly damaging Het
Cep120 C T 18: 53,718,489 R577Q probably damaging Het
Cplx4 T C 18: 65,969,977 E24G possibly damaging Het
D430042O09Rik A G 7: 125,865,351 S1297G probably damaging Het
Dcxr T C 11: 120,726,097 T147A probably benign Het
Dnajc10 C A 2: 80,340,526 H454N probably damaging Het
Dsp G T 13: 38,167,528 G108* probably null Het
Entpd6 T A 2: 150,767,094 I366K probably damaging Het
Fam111a A G 19: 12,587,693 K269E probably benign Het
Grid2ip T G 5: 143,375,700 V222G possibly damaging Het
Hmcn2 T G 2: 31,445,314 V4421G probably benign Het
Ifi207 T C 1: 173,727,687 T817A probably damaging Het
Irak2 A T 6: 113,693,722 E533V probably damaging Het
Kbtbd6 T C 14: 79,452,156 F97S probably damaging Het
Kctd14 A T 7: 97,457,676 E99V probably damaging Het
Klhl10 A T 11: 100,447,731 Y432F probably benign Het
Lrrc49 T C 9: 60,685,052 N53S possibly damaging Het
Mief2 T A 11: 60,730,462 probably benign Het
Mog A T 17: 37,023,157 S15T unknown Het
Mpi T C 9: 57,544,898 D365G probably damaging Het
Mpp7 A G 18: 7,379,983 probably null Het
Nes A G 3: 87,976,179 T582A probably benign Het
Nlrp14 A G 7: 107,181,186 D5G probably benign Het
Nr1i3 C T 1: 171,217,150 T218I probably damaging Het
Nup43 C T 10: 7,678,669 R339* probably null Het
Nupl1 T A 14: 60,220,022 R577S probably benign Het
Olfr1016 G A 2: 85,799,994 S92F probably damaging Het
Olfr1161 T A 2: 88,024,863 I47K probably damaging Het
Olfr503 T A 7: 108,544,885 M120K probably damaging Het
Olfr724 AAATTTGAA AAA 14: 49,960,995 probably benign Het
Olfr768 A T 10: 129,093,668 V102D possibly damaging Het
Olfr908 C T 9: 38,516,601 probably benign Het
Orc1 T C 4: 108,579,568 probably benign Het
Pax6 C A 2: 105,696,502 P251Q probably benign Het
Phactr3 C T 2: 178,283,936 R330W probably damaging Het
Phldb1 G A 9: 44,711,027 R81W probably damaging Het
Pip5k1c C T 10: 81,315,940 P656L probably benign Het
Pkn3 T G 2: 30,084,680 probably null Het
Plcb2 T A 2: 118,713,134 H752L probably benign Het
Plch1 G A 3: 63,753,325 T291M probably damaging Het
Plk4 A G 3: 40,805,190 T174A probably damaging Het
Ppip5k2 C A 1: 97,721,067 probably benign Het
Prl2a1 G A 13: 27,804,978 V29M probably benign Het
R3hcc1l T C 19: 42,583,557 probably benign Het
Rasa3 C T 8: 13,598,289 G125D probably damaging Het
Sema3f A T 9: 107,689,720 Y136* probably null Het
Slc13a5 T A 11: 72,250,846 probably null Het
Slc16a1 T C 3: 104,653,564 V395A possibly damaging Het
Sparcl1 C T 5: 104,088,490 A466T probably benign Het
Srrm1 G A 4: 135,342,379 probably benign Het
Styxl1 G A 5: 135,768,901 R50* probably null Het
Tex264 T A 9: 106,673,702 I99F possibly damaging Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmem245 A C 4: 56,937,989 probably null Het
Tnik A T 3: 28,607,210 T587S probably benign Het
Tpr T G 1: 150,413,113 S648A possibly damaging Het
Ttn T C 2: 76,765,969 E18454G probably damaging Het
Utp20 A C 10: 88,809,935 H527Q probably benign Het
Vmn1r1 A T 1: 182,157,546 S185T probably benign Het
Vps54 C T 11: 21,312,952 H680Y probably damaging Het
Vwa5b2 A G 16: 20,600,803 probably null Het
Wscd1 T C 11: 71,771,976 probably null Het
Zbtb41 C T 1: 139,447,414 P871S probably damaging Het
Zcchc4 T C 5: 52,796,207 L186P possibly damaging Het
Zdhhc13 A G 7: 48,799,873 Y73C probably benign Het
Zfp12 A G 5: 143,240,000 E21G probably damaging Het
Other mutations in Plekhg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Plekhg1 APN 10 3963631 missense probably benign 0.02
IGL01639:Plekhg1 APN 10 3956751 missense probably damaging 0.98
IGL01766:Plekhg1 APN 10 3873400 missense probably damaging 1.00
IGL01983:Plekhg1 APN 10 3945904 missense probably damaging 1.00
IGL02226:Plekhg1 APN 10 3945916 missense probably damaging 0.99
IGL02420:Plekhg1 APN 10 3964106 missense probably damaging 1.00
IGL02441:Plekhg1 APN 10 3958103 missense possibly damaging 0.89
IGL02505:Plekhg1 APN 10 3957139 missense probably damaging 0.97
IGL02659:Plekhg1 APN 10 3957069 nonsense probably null
IGL02730:Plekhg1 APN 10 3873242 missense possibly damaging 0.59
PIT4453001:Plekhg1 UTSW 10 3963469 missense
R0041:Plekhg1 UTSW 10 3964076 nonsense probably null
R0041:Plekhg1 UTSW 10 3964074 missense probably benign 0.02
R0068:Plekhg1 UTSW 10 3940502 missense probably damaging 0.99
R0068:Plekhg1 UTSW 10 3940504 nonsense probably null
R0333:Plekhg1 UTSW 10 3964419 missense probably damaging 1.00
R0427:Plekhg1 UTSW 10 3964235 missense probably benign 0.01
R0499:Plekhg1 UTSW 10 3937971 missense probably damaging 1.00
R0504:Plekhg1 UTSW 10 3937853 missense probably damaging 1.00
R1499:Plekhg1 UTSW 10 3940538 splice site probably benign
R1501:Plekhg1 UTSW 10 3957361 missense probably benign 0.02
R1565:Plekhg1 UTSW 10 3940526 missense probably damaging 1.00
R1801:Plekhg1 UTSW 10 3963904 missense probably damaging 1.00
R1823:Plekhg1 UTSW 10 3903658 critical splice donor site probably null
R1858:Plekhg1 UTSW 10 3945917 missense possibly damaging 0.95
R1984:Plekhg1 UTSW 10 3958181 missense probably damaging 1.00
R2420:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2421:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2422:Plekhg1 UTSW 10 3958048 missense probably benign 0.39
R2437:Plekhg1 UTSW 10 3963564 missense probably damaging 1.00
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R2872:Plekhg1 UTSW 10 3963982 missense probably benign
R3830:Plekhg1 UTSW 10 3873400 missense probably damaging 1.00
R4058:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4059:Plekhg1 UTSW 10 3957087 missense probably damaging 1.00
R4649:Plekhg1 UTSW 10 3956985 missense probably benign 0.00
R4731:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4732:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4733:Plekhg1 UTSW 10 3957506 missense probably benign 0.01
R4772:Plekhg1 UTSW 10 3873127 missense probably benign 0.00
R4803:Plekhg1 UTSW 10 3957186 missense probably benign 0.02
R5086:Plekhg1 UTSW 10 3903649 missense probably damaging 1.00
R5175:Plekhg1 UTSW 10 3965516 unclassified probably benign
R5283:Plekhg1 UTSW 10 3956654 missense probably benign 0.00
R5862:Plekhg1 UTSW 10 3937914 missense probably damaging 1.00
R6163:Plekhg1 UTSW 10 3964369 missense probably damaging 1.00
R6564:Plekhg1 UTSW 10 3964153 missense probably damaging 1.00
R6700:Plekhg1 UTSW 10 3957373 missense probably benign
R6930:Plekhg1 UTSW 10 3963770 missense possibly damaging 0.56
R7033:Plekhg1 UTSW 10 3940251 missense probably damaging 0.97
R7200:Plekhg1 UTSW 10 3956810 missense
R7223:Plekhg1 UTSW 10 3873343 missense
R7353:Plekhg1 UTSW 10 3964327 missense
R7488:Plekhg1 UTSW 10 3957491 missense
R7554:Plekhg1 UTSW 10 3963647 missense
Predicted Primers PCR Primer
(F):5'- ACGTGCCTTCAGCTGTAAGTC -3'
(R):5'- TACATAGAGGAGCTTGGGGC -3'

Sequencing Primer
(F):5'- AGTCTAGTTCCTGATCCAAGGAC -3'
(R):5'- TGGCCGAGTCTGCAGTG -3'
Posted On2015-12-29