Mutagenetix > Incidental Mutations

Incidental Mutation 'R4772:Dsp'

367630

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 38167528 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Stop codon at position 108 (G108*)

Ref Sequence

ENSEMBL: ENSMUSP00000117252 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

Predicted Effect

probably null
Transcript: ENSMUST00000124830
AA Change: G108*

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: G108*

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000127906
AA Change: G108*

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: G108*

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Meta Mutation Damage Score

0.594

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

95% (74/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,315,339		probably null	Het
Adamts19	A	G	18: 58,837,776	Q144R	possibly damaging	Het
Adgrb3	C	A	1: 25,531,875	C507F	probably damaging	Het
Atg9b	T	C	5: 24,385,239	*923W	probably null	Het
Atp13a4	T	C	16: 29,420,835		probably benign	Het
Baz2b	G	T	2: 59,958,451	R697S	probably damaging	Het
Bicdl1	A	G	5: 115,661,478	I184T	probably benign	Het
Bpifb4	C	T	2: 153,942,983	L204F	possibly damaging	Het
Cep120	C	T	18: 53,718,489	R577Q	probably damaging	Het
Cplx4	T	C	18: 65,969,977	E24G	possibly damaging	Het
D430042O09Rik	A	G	7: 125,865,351	S1297G	probably damaging	Het
Dcxr	T	C	11: 120,726,097	T147A	probably benign	Het
Dnajc10	C	A	2: 80,340,526	H454N	probably damaging	Het
Entpd6	T	A	2: 150,767,094	I366K	probably damaging	Het
Fam111a	A	G	19: 12,587,693	K269E	probably benign	Het
Grid2ip	T	G	5: 143,375,700	V222G	possibly damaging	Het
Hmcn2	T	G	2: 31,445,314	V4421G	probably benign	Het
Ifi207	T	C	1: 173,727,687	T817A	probably damaging	Het
Irak2	A	T	6: 113,693,722	E533V	probably damaging	Het
Kbtbd6	T	C	14: 79,452,156	F97S	probably damaging	Het
Kctd14	A	T	7: 97,457,676	E99V	probably damaging	Het
Klhl10	A	T	11: 100,447,731	Y432F	probably benign	Het
Lrrc49	T	C	9: 60,685,052	N53S	possibly damaging	Het
Mief2	T	A	11: 60,730,462		probably benign	Het
Mog	A	T	17: 37,023,157	S15T	unknown	Het
Mpi	T	C	9: 57,544,898	D365G	probably damaging	Het
Mpp7	A	G	18: 7,379,983		probably null	Het
Nes	A	G	3: 87,976,179	T582A	probably benign	Het
Nlrp14	A	G	7: 107,181,186	D5G	probably benign	Het
Nr1i3	C	T	1: 171,217,150	T218I	probably damaging	Het
Nup43	C	T	10: 7,678,669	R339*	probably null	Het
Nupl1	T	A	14: 60,220,022	R577S	probably benign	Het
Olfr1016	G	A	2: 85,799,994	S92F	probably damaging	Het
Olfr1161	T	A	2: 88,024,863	I47K	probably damaging	Het
Olfr503	T	A	7: 108,544,885	M120K	probably damaging	Het
Olfr724	AAATTTGAA	AAA	14: 49,960,995		probably benign	Het
Olfr768	A	T	10: 129,093,668	V102D	possibly damaging	Het
Olfr908	C	T	9: 38,516,601		probably benign	Het
Orc1	T	C	4: 108,579,568		probably benign	Het
Pax6	C	A	2: 105,696,502	P251Q	probably benign	Het
Phactr3	C	T	2: 178,283,936	R330W	probably damaging	Het
Phldb1	G	A	9: 44,711,027	R81W	probably damaging	Het
Pip5k1c	C	T	10: 81,315,940	P656L	probably benign	Het
Pkn3	T	G	2: 30,084,680		probably null	Het
Plcb2	T	A	2: 118,713,134	H752L	probably benign	Het
Plch1	G	A	3: 63,753,325	T291M	probably damaging	Het
Plekhg1	A	T	10: 3,873,127	M32L	probably benign	Het
Plekhg1	A	T	10: 3,873,130	T33S	probably damaging	Het
Plk4	A	G	3: 40,805,190	T174A	probably damaging	Het
Ppip5k2	C	A	1: 97,721,067		probably benign	Het
Prl2a1	G	A	13: 27,804,978	V29M	probably benign	Het
R3hcc1l	T	C	19: 42,583,557		probably benign	Het
Rasa3	C	T	8: 13,598,289	G125D	probably damaging	Het
Sema3f	A	T	9: 107,689,720	Y136*	probably null	Het
Slc13a5	T	A	11: 72,250,846		probably null	Het
Slc16a1	T	C	3: 104,653,564	V395A	possibly damaging	Het
Sparcl1	C	T	5: 104,088,490	A466T	probably benign	Het
Srrm1	G	A	4: 135,342,379		probably benign	Het
Styxl1	G	A	5: 135,768,901	R50*	probably null	Het
Tex264	T	A	9: 106,673,702	I99F	possibly damaging	Het
Tgtp2	T	C	11: 49,058,984	T254A	probably damaging	Het
Tmem245	A	C	4: 56,937,989		probably null	Het
Tnik	A	T	3: 28,607,210	T587S	probably benign	Het
Tpr	T	G	1: 150,413,113	S648A	possibly damaging	Het
Ttn	T	C	2: 76,765,969	E18454G	probably damaging	Het
Utp20	A	C	10: 88,809,935	H527Q	probably benign	Het
Vmn1r1	A	T	1: 182,157,546	S185T	probably benign	Het
Vps54	C	T	11: 21,312,952	H680Y	probably damaging	Het
Vwa5b2	A	G	16: 20,600,803		probably null	Het
Wscd1	T	C	11: 71,771,976		probably null	Het
Zbtb41	C	T	1: 139,447,414	P871S	probably damaging	Het
Zcchc4	T	C	5: 52,796,207	L186P	possibly damaging	Het
Zdhhc13	A	G	7: 48,799,873	Y73C	probably benign	Het
Zfp12	A	G	5: 143,240,000	E21G	probably damaging	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38197846	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38192687	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38193617	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38167571	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38176495	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38179084	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38181186	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38196523	nonsense	probably null
IGL02833:Dsp	APN	13	38192921	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38188445	splice site	probably benign
IGL03353:Dsp	APN	13	38186695	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38197364	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38196017	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38197705	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38187893	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38172794	missense	probably benign
R0326:Dsp	UTSW	13	38192870	nonsense	probably null
R0332:Dsp	UTSW	13	38182228	nonsense	probably null
R0471:Dsp	UTSW	13	38193350	nonsense	probably null
R0567:Dsp	UTSW	13	38192438	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38187741	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38196764	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38183218	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38183106	splice site	probably benign
R1183:Dsp	UTSW	13	38191740	nonsense	probably null
R1188:Dsp	UTSW	13	38194963	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38186695	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38191931	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38192712	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38181138	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38175147	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38195738	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38193374	nonsense	probably null
R1736:Dsp	UTSW	13	38192990	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38196617	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38193195	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38164855	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38191458	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38196451	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38176407	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38197046	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38193477	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38196404	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38192248	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38193342	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38177199	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38194689	splice site	probably null
R3725:Dsp	UTSW	13	38197618	missense	probably benign	0.00
R3797:Dsp	UTSW	13	38177284	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38197705	missense	probably benign
R4030:Dsp	UTSW	13	38191428	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38186713	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38185231	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38196664	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38195132	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38191632	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38168641	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38196784	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38191619	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38196040	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38195104	missense	possibly damaging	0.51
R4830:Dsp	UTSW	13	38192864	missense	probably benign
R4850:Dsp	UTSW	13	38192469	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38191710	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38197870	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38192910	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38182234	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38197123	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38197702	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38183298	missense	probably benign	0.37
R5138:Dsp	UTSW	13	38195845	missense	possibly damaging	0.50
R5153:Dsp	UTSW	13	38182306	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38192902	nonsense	probably null
R5226:Dsp	UTSW	13	38186770	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38195183	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38194889	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38184038	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38195842	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38192652	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38167501	splice site	probably null
R5910:Dsp	UTSW	13	38192469	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38195434	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38196026	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38195401	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38194958	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38195702	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38167609	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38192047	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38192406	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38197006	nonsense	probably null
R6527:Dsp	UTSW	13	38195873	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38196862	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38167622	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38192210	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38192217	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38167655	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38167646	missense	possibly damaging	0.95
X0023:Dsp	UTSW	13	38197684	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38193255	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38186646	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38182312	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- AACTGTAGCGTGTCATTTTACTTTC -3'
(R):5'- AAGTCACCTGCTAGGGGTC -3'

Sequencing Primer
(F):5'- GCAAGTACTGAGCTATCTCACTGG -3'
(R):5'- CCTCATCTCTCGGATCAA -3'

Posted On

2015-12-29