Incidental Mutation 'R4773:Olfr218'
ID367649
Institutional Source Beutler Lab
Gene Symbol Olfr218
Ensembl Gene ENSMUSG00000046643
Gene Nameolfactory receptor 218
SynonymsOlfr1405-ps1, GA_x6K02T2R7CC-643715-642847, GA_x6K02SYWG4P-534-1100, MOR267-3, MOR267-3
MMRRC Submission 042411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R4773 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173197808-173206336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 173204229 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 291 (Y291S)
Ref Sequence ENSEMBL: ENSMUSP00000150815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057548] [ENSMUST00000215844] [ENSMUST00000216603]
Predicted Effect probably damaging
Transcript: ENSMUST00000057548
AA Change: Y291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053317
Gene: ENSMUSG00000046643
AA Change: Y291S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 3.4e-58 PFAM
Pfam:7tm_1 42 291 2.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215844
AA Change: Y291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216603
AA Change: Y291S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0732 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,598 probably null Het
9230009I02Rik A G 11: 51,091,262 noncoding transcript Het
Actl7b T C 4: 56,740,972 I129V probably benign Het
Adipor2 A G 6: 119,359,086 L225P probably benign Het
Arhgap25 A G 6: 87,496,071 F35L probably benign Het
Asah2 A T 19: 32,052,858 M138K probably damaging Het
Asxl1 T A 2: 153,401,985 M1486K probably damaging Het
B4galt4 T A 16: 38,752,296 S114R probably benign Het
Brpf3 T G 17: 28,821,259 S885A probably benign Het
Cacna1g G T 11: 94,411,472 H1944N possibly damaging Het
Ccdc110 G A 8: 45,943,208 C712Y probably damaging Het
Ccdc175 A T 12: 72,136,048 I399N probably damaging Het
Cct8l1 A T 5: 25,517,756 T490S probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Copa A G 1: 172,105,220 N371D probably damaging Het
Cpeb1 A T 7: 81,355,947 H381Q probably benign Het
Cyp2d40 T A 15: 82,761,562 I81F possibly damaging Het
Dscc1 A T 15: 55,080,258 D405E probably benign Het
Ece1 A G 4: 137,945,153 D369G probably benign Het
Exd2 T C 12: 80,475,818 V17A possibly damaging Het
Fam111a A T 19: 12,588,408 N507I possibly damaging Het
Flnc T C 6: 29,445,039 V719A possibly damaging Het
Fscb C T 12: 64,473,690 G334D probably damaging Het
Glud1 T C 14: 34,321,825 probably null Het
Gm8126 T A 14: 43,261,615 Y180* probably null Het
Grip2 G A 6: 91,782,432 P347L possibly damaging Het
H60b C T 10: 22,288,745 probably benign Het
Hist1h1d T C 13: 23,555,402 S105P probably damaging Het
Itga6 T C 2: 71,822,444 V217A probably benign Het
Kndc1 G A 7: 139,924,031 W1083* probably null Het
Limch1 A T 5: 67,027,507 D613V probably damaging Het
Lpl T A 8: 68,896,751 C310S probably damaging Het
March1 T A 8: 66,387,224 C220S probably benign Het
Mbd5 A C 2: 49,274,611 H308P probably damaging Het
Med13 T C 11: 86,276,920 D2003G probably damaging Het
Mettl16 T A 11: 74,817,301 V442D possibly damaging Het
Mstn A T 1: 53,062,108 T115S probably benign Het
Nfil3 A G 13: 52,968,014 S285P probably damaging Het
Olfr645 A G 7: 104,084,295 S262P probably damaging Het
Otof A G 5: 30,394,682 V321A probably benign Het
Pcdha8 G T 18: 36,994,573 A703S probably damaging Het
Pcdhb18 A G 18: 37,490,454 Y279C probably damaging Het
Pdgfa T C 5: 138,993,296 D51G probably benign Het
Pdzd8 A G 19: 59,300,860 Y703H probably damaging Het
Pecr G T 1: 72,267,435 P229Q probably damaging Het
Phkg1 G T 5: 129,873,273 probably null Het
Plxnb2 A T 15: 89,166,947 H356Q probably benign Het
Polr1b T C 2: 129,105,328 I191T probably benign Het
Ppp4r3a A G 12: 101,082,767 L35P possibly damaging Het
Rasa2 C T 9: 96,544,417 G792D probably benign Het
Rps11-ps4 T C 12: 51,297,623 noncoding transcript Het
Sema3g A G 14: 31,220,709 D89G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slfn8 A G 11: 83,017,393 V108A probably damaging Het
Smg9 T A 7: 24,407,594 M221K possibly damaging Het
Soga1 G T 2: 157,030,569 Q953K probably benign Het
Sos1 A G 17: 80,398,231 S1304P probably damaging Het
Spert T A 14: 75,583,106 Y393F probably damaging Het
Sqle C A 15: 59,317,839 A110E possibly damaging Het
Stab2 G A 10: 86,907,371 Q1154* probably null Het
Taf4b A G 18: 14,804,520 T217A probably benign Het
Tex15 T C 8: 33,582,732 V2769A probably benign Het
Tmem156 A T 5: 65,080,159 C53S probably damaging Het
Tmtc3 T A 10: 100,457,139 K452N possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 T C 7: 46,656,952 E195G probably damaging Het
Trpc6 T A 9: 8,609,851 Y107N possibly damaging Het
Tsga10 G A 1: 37,835,525 T93I probably damaging Het
Ttc25 C A 11: 100,549,916 N74K probably benign Het
Ttn T A 2: 76,741,434 N26372Y probably damaging Het
Tubd1 T C 11: 86,555,302 L256P possibly damaging Het
Txnrd2 C G 16: 18,440,819 A126G probably benign Het
Vmn1r210 T G 13: 22,827,204 K304T probably benign Het
Vps25 T C 11: 101,258,829 S160P probably benign Het
Vrk3 T A 7: 44,775,476 D438E probably benign Het
Vwa5b1 A G 4: 138,581,755 L708P probably benign Het
Washc3 C T 10: 88,219,262 Q105* probably null Het
Wdr83os T A 8: 85,080,781 probably benign Het
Wwc1 T C 11: 35,867,296 H741R probably benign Het
Zan T C 5: 137,436,313 probably benign Het
Zdhhc4 A T 5: 143,326,176 L14I possibly damaging Het
Zfp568 T A 7: 29,997,770 D38E probably damaging Het
Other mutations in Olfr218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03404:Olfr218 APN 1 173204199 missense probably benign 0.08
R0265:Olfr218 UTSW 1 173203917 missense probably benign 0.10
R1388:Olfr218 UTSW 1 173203878 missense probably benign 0.01
R1463:Olfr218 UTSW 1 173203367 missense probably benign
R1547:Olfr218 UTSW 1 173203672 nonsense probably null
R1698:Olfr218 UTSW 1 173203371 missense probably damaging 1.00
R1892:Olfr218 UTSW 1 173204228 missense probably damaging 1.00
R4939:Olfr218 UTSW 1 173203463 missense possibly damaging 0.95
R5473:Olfr218 UTSW 1 173204165 missense probably benign 0.02
R6149:Olfr218 UTSW 1 173204015 missense probably benign 0.15
R6582:Olfr218 UTSW 1 173204280 missense probably benign 0.00
R7151:Olfr218 UTSW 1 173204066 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTGCCTCAGCTGAAGG -3'
(R):5'- ACTTGCATGCATATAAAGGCAC -3'

Sequencing Primer
(F):5'- CTCAGCTGAAGGCCGGAAG -3'
(R):5'- GCATGCATATAAAGGCACTAAAATG -3'
Posted On2015-12-29