Incidental Mutation 'R4773:Polr1b'
ID367653
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
MMRRC Submission 042411-MU
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4773 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129105328 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 191 (I191T)
Ref Sequence ENSEMBL: ENSMUSP00000028874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000103205]
Predicted Effect probably benign
Transcript: ENSMUST00000028874
AA Change: I191T

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395
AA Change: I191T

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103205
AA Change: I191T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395
AA Change: I191T

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 100% (89/89)
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik A G 5: 24,550,598 probably null Het
9230009I02Rik A G 11: 51,091,262 noncoding transcript Het
Actl7b T C 4: 56,740,972 I129V probably benign Het
Adipor2 A G 6: 119,359,086 L225P probably benign Het
Arhgap25 A G 6: 87,496,071 F35L probably benign Het
Asah2 A T 19: 32,052,858 M138K probably damaging Het
Asxl1 T A 2: 153,401,985 M1486K probably damaging Het
B4galt4 T A 16: 38,752,296 S114R probably benign Het
Brpf3 T G 17: 28,821,259 S885A probably benign Het
Cacna1g G T 11: 94,411,472 H1944N possibly damaging Het
Ccdc110 G A 8: 45,943,208 C712Y probably damaging Het
Ccdc175 A T 12: 72,136,048 I399N probably damaging Het
Cct8l1 A T 5: 25,517,756 T490S probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Copa A G 1: 172,105,220 N371D probably damaging Het
Cpeb1 A T 7: 81,355,947 H381Q probably benign Het
Cyp2d40 T A 15: 82,761,562 I81F possibly damaging Het
Dscc1 A T 15: 55,080,258 D405E probably benign Het
Ece1 A G 4: 137,945,153 D369G probably benign Het
Exd2 T C 12: 80,475,818 V17A possibly damaging Het
Fam111a A T 19: 12,588,408 N507I possibly damaging Het
Flnc T C 6: 29,445,039 V719A possibly damaging Het
Fscb C T 12: 64,473,690 G334D probably damaging Het
Glud1 T C 14: 34,321,825 probably null Het
Gm8126 T A 14: 43,261,615 Y180* probably null Het
Grip2 G A 6: 91,782,432 P347L possibly damaging Het
H60b C T 10: 22,288,745 probably benign Het
Hist1h1d T C 13: 23,555,402 S105P probably damaging Het
Itga6 T C 2: 71,822,444 V217A probably benign Het
Kndc1 G A 7: 139,924,031 W1083* probably null Het
Limch1 A T 5: 67,027,507 D613V probably damaging Het
Lpl T A 8: 68,896,751 C310S probably damaging Het
March1 T A 8: 66,387,224 C220S probably benign Het
Mbd5 A C 2: 49,274,611 H308P probably damaging Het
Med13 T C 11: 86,276,920 D2003G probably damaging Het
Mettl16 T A 11: 74,817,301 V442D possibly damaging Het
Mstn A T 1: 53,062,108 T115S probably benign Het
Nfil3 A G 13: 52,968,014 S285P probably damaging Het
Olfr218 A C 1: 173,204,229 Y291S probably damaging Het
Olfr645 A G 7: 104,084,295 S262P probably damaging Het
Otof A G 5: 30,394,682 V321A probably benign Het
Pcdha8 G T 18: 36,994,573 A703S probably damaging Het
Pcdhb18 A G 18: 37,490,454 Y279C probably damaging Het
Pdgfa T C 5: 138,993,296 D51G probably benign Het
Pdzd8 A G 19: 59,300,860 Y703H probably damaging Het
Pecr G T 1: 72,267,435 P229Q probably damaging Het
Phkg1 G T 5: 129,873,273 probably null Het
Plxnb2 A T 15: 89,166,947 H356Q probably benign Het
Ppp4r3a A G 12: 101,082,767 L35P possibly damaging Het
Rasa2 C T 9: 96,544,417 G792D probably benign Het
Rps11-ps4 T C 12: 51,297,623 noncoding transcript Het
Sema3g A G 14: 31,220,709 D89G probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slfn8 A G 11: 83,017,393 V108A probably damaging Het
Smg9 T A 7: 24,407,594 M221K possibly damaging Het
Soga1 G T 2: 157,030,569 Q953K probably benign Het
Sos1 A G 17: 80,398,231 S1304P probably damaging Het
Spert T A 14: 75,583,106 Y393F probably damaging Het
Sqle C A 15: 59,317,839 A110E possibly damaging Het
Stab2 G A 10: 86,907,371 Q1154* probably null Het
Taf4b A G 18: 14,804,520 T217A probably benign Het
Tex15 T C 8: 33,582,732 V2769A probably benign Het
Tmem156 A T 5: 65,080,159 C53S probably damaging Het
Tmtc3 T A 10: 100,457,139 K452N possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tph1 T C 7: 46,656,952 E195G probably damaging Het
Trpc6 T A 9: 8,609,851 Y107N possibly damaging Het
Tsga10 G A 1: 37,835,525 T93I probably damaging Het
Ttc25 C A 11: 100,549,916 N74K probably benign Het
Ttn T A 2: 76,741,434 N26372Y probably damaging Het
Tubd1 T C 11: 86,555,302 L256P possibly damaging Het
Txnrd2 C G 16: 18,440,819 A126G probably benign Het
Vmn1r210 T G 13: 22,827,204 K304T probably benign Het
Vps25 T C 11: 101,258,829 S160P probably benign Het
Vrk3 T A 7: 44,775,476 D438E probably benign Het
Vwa5b1 A G 4: 138,581,755 L708P probably benign Het
Washc3 C T 10: 88,219,262 Q105* probably null Het
Wdr83os T A 8: 85,080,781 probably benign Het
Wwc1 T C 11: 35,867,296 H741R probably benign Het
Zan T C 5: 137,436,313 probably benign Het
Zdhhc4 A T 5: 143,326,176 L14I possibly damaging Het
Zfp568 T A 7: 29,997,770 D38E probably damaging Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
PIT4362001:Polr1b UTSW 2 129109292 missense possibly damaging 0.84
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ACTTACCCTGGAGCTTGTTCTG -3'
(R):5'- GTTTACACATGGATCAACACTCCC -3'

Sequencing Primer
(F):5'- TCTGTTTCCAGAGCCCGG -3'
(R):5'- TTCACCCTGAACATCATAGAAGTG -3'
Posted On2015-12-29