Incidental Mutation 'R0413:Zfp462'
ID36770
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Namezinc finger protein 462
SynonymsZfpip, 9430078C22Rik, Gt4-2
MMRRC Submission 038615-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.517) question?
Stock #R0413 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location54945048-55083563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55010534 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 833 (R833S)
Ref Sequence ENSEMBL: ENSMUSP00000095677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070] [ENSMUST00000133895]
Predicted Effect probably benign
Transcript: ENSMUST00000030131
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098070
AA Change: R833S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: R833S

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133895
SMART Domains Protein: ENSMUSP00000122775
Gene: ENSMUSG00000060206

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 93 N/A INTRINSIC
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,328,011 probably benign Het
Adh1 C T 3: 138,280,432 T60I probably benign Het
Agtpbp1 T A 13: 59,514,152 I282F probably benign Het
AI464131 G T 4: 41,498,585 H348Q probably benign Het
Arih2 G T 9: 108,616,717 Q166K probably damaging Het
BC027072 T G 17: 71,752,217 D155A probably benign Het
Cacna1s A G 1: 136,098,209 T1031A probably benign Het
Ccdc102a C A 8: 94,903,286 E542D probably benign Het
Cdk1 T C 10: 69,345,099 I94V probably benign Het
Cep290 C T 10: 100,523,314 Q969* probably null Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Col12a1 T C 9: 79,699,360 T594A probably damaging Het
Cpox A G 16: 58,670,869 T148A possibly damaging Het
Csf3r A G 4: 126,039,667 probably benign Het
Csmd1 A T 8: 16,710,514 C202S probably damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dnah9 T A 11: 66,108,135 Y1029F probably damaging Het
Dok5 T C 2: 170,829,960 probably benign Het
Dusp11 A T 6: 85,952,370 probably benign Het
Edar T C 10: 58,629,440 N34D probably benign Het
Efcab7 C T 4: 99,909,746 T56I probably damaging Het
Entpd1 G A 19: 40,711,285 V47I probably benign Het
Ephx4 A G 5: 107,403,735 N62S probably benign Het
Etaa1 A T 11: 17,946,350 L589* probably null Het
Fam135b T A 15: 71,463,821 N508I probably benign Het
Fam193a T C 5: 34,466,208 V27A possibly damaging Het
Fmnl1 A G 11: 103,194,063 probably benign Het
Fstl1 A C 16: 37,821,154 probably null Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gemin4 T C 11: 76,211,322 Y871C probably benign Het
Gm7247 T C 14: 51,523,472 V166A probably benign Het
Gpcpd1 A T 2: 132,564,623 probably benign Het
Gpnmb A G 6: 49,042,803 D36G probably benign Het
Ido2 C T 8: 24,558,143 probably null Het
Igfn1 G A 1: 135,967,596 T1744I probably benign Het
Inf2 T G 12: 112,601,676 F221V probably damaging Het
Itga10 T A 3: 96,649,059 I170N probably damaging Het
Lrp6 A T 6: 134,507,624 D345E probably damaging Het
Macf1 A T 4: 123,472,269 S2900T probably benign Het
Med13 C A 11: 86,299,207 probably benign Het
Morc3 T C 16: 93,870,474 V507A probably damaging Het
Myadm AC ACC 7: 3,296,760 probably null Het
Myl6 C T 10: 128,492,222 probably benign Het
Mylk T C 16: 34,921,944 V942A probably benign Het
Ncdn G T 4: 126,750,534 T165K possibly damaging Het
Ncf1 T C 5: 134,222,802 probably benign Het
Neb T C 2: 52,290,739 probably benign Het
Nid1 T A 13: 13,482,096 I604N probably benign Het
Nsrp1 T C 11: 77,046,171 R400G probably benign Het
Nup43 T G 10: 7,671,027 I137S probably benign Het
Nynrin A G 14: 55,872,191 N1585S possibly damaging Het
Obscn T A 11: 59,002,997 Y6748F probably benign Het
Olfr1058 G A 2: 86,385,714 R235C probably benign Het
Olfr1211 A G 2: 88,929,562 V251A probably benign Het
Olfr1389 T C 11: 49,431,385 V303A possibly damaging Het
Olfr60 A T 7: 140,345,195 S265T possibly damaging Het
Olfr623 A T 7: 103,660,750 F167I possibly damaging Het
Olfr67 A G 7: 103,788,155 Y41H probably damaging Het
Olfr944 A G 9: 39,218,270 I304M probably benign Het
Olfr992 T C 2: 85,399,675 N286S probably damaging Het
Omg A G 11: 79,502,835 S66P possibly damaging Het
Ormdl1 C T 1: 53,308,819 probably benign Het
Ovch2 T A 7: 107,782,036 I552L probably benign Het
Pcsk9 G T 4: 106,454,341 T231N probably damaging Het
Pgpep1 T C 8: 70,657,450 N22S probably damaging Het
Plb1 T C 5: 32,355,362 F1355L probably damaging Het
Plcg1 G T 2: 160,761,429 L1173F probably damaging Het
Plch2 A T 4: 155,006,916 probably null Het
Ppp1r3g T A 13: 35,969,348 F250L probably damaging Het
Prkcg A G 7: 3,319,579 I381V probably benign Het
Pum2 C T 12: 8,713,464 A207V probably benign Het
Rabac1 T C 7: 24,970,182 E166G probably damaging Het
Rad21l G A 2: 151,651,931 S450L probably benign Het
Rangap1 ACACTCA ACA 15: 81,716,675 probably null Het
Reg3b G T 6: 78,371,841 C40F probably damaging Het
Rfx2 A G 17: 56,784,418 probably benign Het
Rrp15 G A 1: 186,749,149 probably benign Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Sec61a2 A T 2: 5,876,354 probably benign Het
Sema5a A G 15: 32,669,444 K705E probably damaging Het
Setx A G 2: 29,139,278 Y186C probably damaging Het
Slc22a23 T C 13: 34,183,132 E631G probably damaging Het
Slc5a5 T C 8: 70,891,675 T134A possibly damaging Het
Stx7 T C 10: 24,181,594 S173P probably damaging Het
Sybu T C 15: 44,673,272 T353A probably damaging Het
Syde2 T A 3: 146,007,132 N1008K probably damaging Het
Tiam1 T C 16: 89,809,365 probably benign Het
Timm10b G A 7: 105,678,330 E61K probably benign Het
Tm2d1 A G 4: 98,365,573 I121T probably damaging Het
Trim75 T C 8: 64,983,240 E186G probably benign Het
Tti1 T C 2: 157,995,476 K895E probably benign Het
Vmn1r43 A G 6: 89,869,848 S219P probably damaging Het
Vmn2r73 A T 7: 85,871,879 S294T possibly damaging Het
Vmn2r94 A T 17: 18,243,818 F737I probably damaging Het
Vsx2 A T 12: 84,570,003 T21S probably benign Het
Wrb T G 16: 96,153,017 S105R probably benign Het
Zfpl1 G A 19: 6,082,452 P143L probably damaging Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55011483 unclassified probably null
IGL00421:Zfp462 APN 4 55023576 missense probably benign 0.00
IGL00899:Zfp462 APN 4 55007732 missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55013181 missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55008912 missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55008586 missense probably benign 0.20
IGL01862:Zfp462 APN 4 55023441 missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55012138 missense probably benign 0.04
IGL02029:Zfp462 APN 4 55079395 splice site probably benign
IGL02338:Zfp462 APN 4 55010292 missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55012986 missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55060236 missense probably null 1.00
IGL02815:Zfp462 APN 4 55051303 missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55080785 missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55009757 unclassified probably benign
FR4304:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009761 unclassified probably benign
P0035:Zfp462 UTSW 4 55009086 missense probably benign
R0052:Zfp462 UTSW 4 55011762 missense probably benign 0.03
R0143:Zfp462 UTSW 4 55023402 splice site probably benign
R0145:Zfp462 UTSW 4 55010529 missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55079314 missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55008768 missense probably benign
R0359:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0554:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55011951 missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55007563 start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55013000 missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55060046 missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55007667 missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55009002 missense probably benign
R1541:Zfp462 UTSW 4 55008928 missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55013489 missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55010010 missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55010830 missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55008496 missense probably benign 0.00
R2148:Zfp462 UTSW 4 55013670 missense probably benign 0.01
R2179:Zfp462 UTSW 4 55009524 missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55013712 missense probably benign
R2352:Zfp462 UTSW 4 55008313 missense probably null
R2566:Zfp462 UTSW 4 55008522 missense probably benign 0.00
R3879:Zfp462 UTSW 4 55060095 missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55012402 missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55008411 missense probably benign 0.00
R4413:Zfp462 UTSW 4 55012672 missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55011889 missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55012981 missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55009349 missense probably benign
R4682:Zfp462 UTSW 4 55011376 missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55008612 missense probably benign
R4744:Zfp462 UTSW 4 55011598 missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55013476 missense probably benign 0.00
R4819:Zfp462 UTSW 4 55060044 missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55012213 missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55010668 missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55009444 missense probably benign 0.02
R4891:Zfp462 UTSW 4 55060055 missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55051204 missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55010667 missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55016986 splice site probably null
R5173:Zfp462 UTSW 4 55011115 missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55016887 missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55012299 missense probably benign
R5314:Zfp462 UTSW 4 55013178 missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55060077 missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55009818 missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55050281 missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55013464 missense probably benign 0.01
R5775:Zfp462 UTSW 4 55010590 missense probably damaging 0.99
R6126:Zfp462 UTSW 4 55023573 missense probably benign 0.01
R6280:Zfp462 UTSW 4 55010253 missense probably benign 0.00
R6325:Zfp462 UTSW 4 55080680 missense probably benign 0.04
R6542:Zfp462 UTSW 4 55023433 missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55012324 unclassified probably null
R6663:Zfp462 UTSW 4 55008933 missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55012326 missense probably benign 0.01
R6889:Zfp462 UTSW 4 55007671 missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55009544 missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55007775 missense probably benign 0.25
R6988:Zfp462 UTSW 4 55080716 missense probably benign 0.00
R7131:Zfp462 UTSW 4 55009380 missense probably benign
R7151:Zfp462 UTSW 4 55051271 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATTACACTGCCACCAATGGGG -3'
(R):5'- TCAGGTCCGAATGGTCAAAGTTGAG -3'

Sequencing Primer
(F):5'- CCAATGGGGCGGAGATCG -3'
(R):5'- CACCATAATGCTGTTGGAGGTC -3'
Posted On2013-05-09