Incidental Mutation 'R4774:Fam129a'
ID367731
Institutional Source Beutler Lab
Gene Symbol Fam129a
Ensembl Gene ENSMUSG00000026483
Gene Namefamily with sequence similarity 129, member A
SynonymsNiban
MMRRC Submission 042412-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4774 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151571186-151721939 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 151715694 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 529 (D529V)
Ref Sequence ENSEMBL: ENSMUSP00000115822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097541] [ENSMUST00000148810]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000086267
Predicted Effect unknown
Transcript: ENSMUST00000097541
AA Change: I581F
SMART Domains Protein: ENSMUSP00000095148
Gene: ENSMUSG00000026483
AA Change: I581F

DomainStartEndE-ValueType
Blast:PH 70 197 2e-83 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148810
AA Change: D529V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115822
Gene: ENSMUSG00000026483
AA Change: D529V

DomainStartEndE-ValueType
SCOP:d1faoa_ 67 118 1e-2 SMART
Blast:PH 70 197 1e-80 BLAST
low complexity region 540 549 N/A INTRINSIC
low complexity region 699 714 N/A INTRINSIC
low complexity region 784 797 N/A INTRINSIC
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family with sequence similarity 129 protein family. This gene is highly expressed in several cancer cells and may serve as a prognostic marker for certain cancers. The encoded protein may play a role in regulating p53-mediated apoptosis. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable with no overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 I844V probably damaging Het
Acnat1 T A 4: 49,450,784 Y109F probably benign Het
Alox12b T C 11: 69,163,207 V205A probably benign Het
Apopt1 A G 12: 111,713,389 T33A possibly damaging Het
Arl6ip1 G A 7: 118,121,985 R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 N24K probably damaging Het
Bdh1 T C 16: 31,455,136 V209A possibly damaging Het
Blm A T 7: 80,463,848 C1234S probably damaging Het
Caml A G 13: 55,631,927 D271G possibly damaging Het
Capn11 T C 17: 45,633,080 D545G probably benign Het
Catspere1 T C 1: 177,937,738 noncoding transcript Het
Ccdc114 T A 7: 45,948,380 S571R probably damaging Het
Cep128 T C 12: 91,234,195 E347G probably damaging Het
Cngb3 A G 4: 19,415,713 T408A possibly damaging Het
Cog1 G A 11: 113,657,427 R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 H2122R probably benign Het
Ctu2 T G 8: 122,481,112 S26A probably benign Het
Dbf4 G A 5: 8,403,062 probably benign Het
Ddx23 A T 15: 98,647,235 D663E probably benign Het
Dpep2 T C 8: 105,990,756 T123A possibly damaging Het
Eed A G 7: 89,964,768 I274T probably damaging Het
Eif3b A G 5: 140,419,500 D47G probably benign Het
Epas1 T C 17: 86,805,758 V124A probably damaging Het
Fer1l6 T C 15: 58,577,949 L668P probably damaging Het
Fnip2 C A 3: 79,465,721 E1017* probably null Het
Gm43517 A T 12: 49,389,907 probably benign Het
Got1 A G 19: 43,502,906 probably null Het
H2-Eb2 T A 17: 34,334,401 V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 probably benign Het
Hpgd T C 8: 56,298,419 V94A probably damaging Het
Htra1 T A 7: 130,985,026 N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 S89R probably damaging Het
Immt C T 6: 71,852,736 T142I probably damaging Het
Itpkb C A 1: 180,418,194 P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 R304S probably benign Het
Lama5 A C 2: 180,185,941 L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 L418V probably null Het
Lrrc4b C A 7: 44,462,372 probably null Het
Lyst A G 13: 13,740,597 N3292S probably damaging Het
Mep1b A T 18: 21,086,184 I132F probably benign Het
Mettl2 A G 11: 105,126,610 probably null Het
Nmd3 T C 3: 69,745,236 L385S probably benign Het
Nol4 T C 18: 22,912,626 E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 I38T probably benign Het
Olfr723 T A 14: 49,929,269 I92F probably damaging Het
Olfr917 A G 9: 38,665,223 I207T probably benign Het
Pcnp A G 16: 56,017,159 probably benign Het
Pla2g6 A C 15: 79,287,618 C680G probably damaging Het
Plekha7 G T 7: 116,144,943 D661E probably damaging Het
Prim1 A T 10: 128,027,018 probably benign Het
Psg29 T A 7: 17,210,535 N323K probably benign Het
Ptrh2 G A 11: 86,690,007 R150H probably damaging Het
Rasa1 A G 13: 85,250,502 probably benign Het
Rasa3 T C 8: 13,577,501 D667G probably benign Het
Rnase2a T C 14: 51,255,744 N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 probably benign Het
Sbp T A 17: 23,945,244 N133K probably damaging Het
Scml4 A G 10: 42,957,747 probably benign Het
Sema5b T A 16: 35,663,182 N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 T33M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 M1V probably null Het
Sorcs3 A G 19: 48,794,163 D1039G probably benign Het
Spon1 A G 7: 114,039,867 E776G probably damaging Het
Tdp1 C T 12: 99,902,364 A259V possibly damaging Het
Tex46 C A 4: 136,610,680 P61Q probably benign Het
Tnr T A 1: 159,897,066 L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpra1 G A 6: 88,910,679 probably benign Het
Trim43c A T 9: 88,847,652 H383L possibly damaging Het
Trip6 A G 5: 137,310,171 C439R probably damaging Het
Tsen2 C T 6: 115,575,933 S398L possibly damaging Het
Tubgcp2 T C 7: 139,996,161 D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc5c A T 3: 141,828,517 E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 R323* probably null Het
Zan G A 5: 137,389,019 T4924I unknown Het
Zfp597 G T 16: 3,865,987 Q302K probably benign Het
Other mutations in Fam129a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Fam129a APN 1 151717721 missense probably benign 0.06
IGL01690:Fam129a APN 1 151703804 missense probably damaging 1.00
IGL01762:Fam129a APN 1 151636491 missense probably damaging 1.00
IGL01784:Fam129a APN 1 151649365 missense probably damaging 1.00
IGL01938:Fam129a APN 1 151689614 missense probably benign 0.22
IGL02427:Fam129a APN 1 151717274 missense probably damaging 1.00
IGL02617:Fam129a APN 1 151571545 missense probably benign 0.11
IGL02946:Fam129a APN 1 151649425 missense probably damaging 0.99
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0242:Fam129a UTSW 1 151718216 missense probably benign 0.00
R0279:Fam129a UTSW 1 151709206 critical splice donor site probably null
R0421:Fam129a UTSW 1 151709082 splice site probably benign
R0531:Fam129a UTSW 1 151718084 missense probably benign 0.11
R0725:Fam129a UTSW 1 151706015 missense probably benign 0.04
R1493:Fam129a UTSW 1 151706090 missense probably damaging 1.00
R1563:Fam129a UTSW 1 151715673 missense possibly damaging 0.69
R1868:Fam129a UTSW 1 151641551 missense possibly damaging 0.71
R1944:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R1945:Fam129a UTSW 1 151696228 missense probably damaging 0.99
R2071:Fam129a UTSW 1 151636430 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151696135 missense probably damaging 1.00
R2126:Fam129a UTSW 1 151709133 missense possibly damaging 0.94
R2138:Fam129a UTSW 1 151696251 missense probably damaging 0.98
R2180:Fam129a UTSW 1 151718078 missense probably benign 0.02
R2402:Fam129a UTSW 1 151689614 missense probably benign 0.22
R3689:Fam129a UTSW 1 151703696 splice site probably null
R3783:Fam129a UTSW 1 151689648 missense possibly damaging 0.66
R3975:Fam129a UTSW 1 151649335 missense probably damaging 1.00
R4029:Fam129a UTSW 1 151695690 missense probably benign 0.00
R4328:Fam129a UTSW 1 151636418 missense possibly damaging 0.86
R4447:Fam129a UTSW 1 151636402 critical splice acceptor site probably null
R4573:Fam129a UTSW 1 151703766 missense possibly damaging 0.85
R5064:Fam129a UTSW 1 151689659 missense probably benign 0.05
R5077:Fam129a UTSW 1 151714523 missense probably benign 0.00
R5187:Fam129a UTSW 1 151703829 missense possibly damaging 0.50
R5484:Fam129a UTSW 1 151718086 missense probably benign 0.08
R5553:Fam129a UTSW 1 151717235 missense probably damaging 0.99
R5572:Fam129a UTSW 1 151709190 missense probably benign 0.05
R5575:Fam129a UTSW 1 151718240 missense probably benign 0.31
R5586:Fam129a UTSW 1 151717556 missense probably benign 0.00
R5697:Fam129a UTSW 1 151700261 missense probably damaging 1.00
R6305:Fam129a UTSW 1 151695718 missense probably damaging 1.00
R7065:Fam129a UTSW 1 151700107 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCGTTCCTGTCTTCTTAAATGTT -3'
(R):5'- ACCAATATCAGTTTCAACTCTCCC -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- CTCGTTCTGACCCTACAGC -3'
Posted On2015-12-29