Incidental Mutation 'R4774:Tpra1'
ID367753
Institutional Source Beutler Lab
Gene Symbol Tpra1
Ensembl Gene ENSMUSG00000002871
Gene Nametransmembrane protein, adipocyte asscociated 1
SynonymsGpr175, Tpra40, 40kDa
MMRRC Submission 042412-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R4774 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location88902251-88912238 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 88910679 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055022] [ENSMUST00000128790] [ENSMUST00000129979] [ENSMUST00000150236] [ENSMUST00000152585] [ENSMUST00000153874] [ENSMUST00000203185] [ENSMUST00000203345] [ENSMUST00000203648] [ENSMUST00000203694] [ENSMUST00000204765]
Predicted Effect probably benign
Transcript: ENSMUST00000055022
SMART Domains Protein: ENSMUSP00000063042
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 36 311 9.9e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128171
SMART Domains Protein: ENSMUSP00000114865
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 1 88 1.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128790
SMART Domains Protein: ENSMUSP00000145116
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 36 206 2e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129979
SMART Domains Protein: ENSMUSP00000145368
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 30 211 2e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148874
Predicted Effect probably benign
Transcript: ENSMUST00000150236
SMART Domains Protein: ENSMUSP00000145098
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 30 212 1.6e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152045
Predicted Effect probably benign
Transcript: ENSMUST00000152585
Predicted Effect probably benign
Transcript: ENSMUST00000153874
SMART Domains Protein: ENSMUSP00000118017
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 32 162 6.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203155
Predicted Effect probably benign
Transcript: ENSMUST00000203185
SMART Domains Protein: ENSMUSP00000145168
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 36 311 9.9e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203345
SMART Domains Protein: ENSMUSP00000144846
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 36 170 6.2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203648
SMART Domains Protein: ENSMUSP00000145404
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 36 222 6.6e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204584
Predicted Effect probably benign
Transcript: ENSMUST00000204765
SMART Domains Protein: ENSMUSP00000145050
Gene: ENSMUSG00000002871

DomainStartEndE-ValueType
Pfam:Tmemb_40 36 311 9.9e-95 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 I844V probably damaging Het
Acnat1 T A 4: 49,450,784 Y109F probably benign Het
Alox12b T C 11: 69,163,207 V205A probably benign Het
Apopt1 A G 12: 111,713,389 T33A possibly damaging Het
Arl6ip1 G A 7: 118,121,985 R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 N24K probably damaging Het
Bdh1 T C 16: 31,455,136 V209A possibly damaging Het
Blm A T 7: 80,463,848 C1234S probably damaging Het
Caml A G 13: 55,631,927 D271G possibly damaging Het
Capn11 T C 17: 45,633,080 D545G probably benign Het
Catspere1 T C 1: 177,937,738 noncoding transcript Het
Ccdc114 T A 7: 45,948,380 S571R probably damaging Het
Cep128 T C 12: 91,234,195 E347G probably damaging Het
Cngb3 A G 4: 19,415,713 T408A possibly damaging Het
Cog1 G A 11: 113,657,427 R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 H2122R probably benign Het
Ctu2 T G 8: 122,481,112 S26A probably benign Het
Dbf4 G A 5: 8,403,062 probably benign Het
Ddx23 A T 15: 98,647,235 D663E probably benign Het
Dpep2 T C 8: 105,990,756 T123A possibly damaging Het
Eed A G 7: 89,964,768 I274T probably damaging Het
Eif3b A G 5: 140,419,500 D47G probably benign Het
Epas1 T C 17: 86,805,758 V124A probably damaging Het
Fam129a A T 1: 151,715,694 D529V probably damaging Het
Fer1l6 T C 15: 58,577,949 L668P probably damaging Het
Fnip2 C A 3: 79,465,721 E1017* probably null Het
Gm43517 A T 12: 49,389,907 probably benign Het
Got1 A G 19: 43,502,906 probably null Het
H2-Eb2 T A 17: 34,334,401 V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 probably benign Het
Hpgd T C 8: 56,298,419 V94A probably damaging Het
Htra1 T A 7: 130,985,026 N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 S89R probably damaging Het
Immt C T 6: 71,852,736 T142I probably damaging Het
Itpkb C A 1: 180,418,194 P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 R304S probably benign Het
Lama5 A C 2: 180,185,941 L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 L418V probably null Het
Lrrc4b C A 7: 44,462,372 probably null Het
Lyst A G 13: 13,740,597 N3292S probably damaging Het
Mep1b A T 18: 21,086,184 I132F probably benign Het
Mettl2 A G 11: 105,126,610 probably null Het
Nmd3 T C 3: 69,745,236 L385S probably benign Het
Nol4 T C 18: 22,912,626 E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 I38T probably benign Het
Olfr723 T A 14: 49,929,269 I92F probably damaging Het
Olfr917 A G 9: 38,665,223 I207T probably benign Het
Pcnp A G 16: 56,017,159 probably benign Het
Pla2g6 A C 15: 79,287,618 C680G probably damaging Het
Plekha7 G T 7: 116,144,943 D661E probably damaging Het
Prim1 A T 10: 128,027,018 probably benign Het
Psg29 T A 7: 17,210,535 N323K probably benign Het
Ptrh2 G A 11: 86,690,007 R150H probably damaging Het
Rasa1 A G 13: 85,250,502 probably benign Het
Rasa3 T C 8: 13,577,501 D667G probably benign Het
Rnase2a T C 14: 51,255,744 N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 probably benign Het
Sbp T A 17: 23,945,244 N133K probably damaging Het
Scml4 A G 10: 42,957,747 probably benign Het
Sema5b T A 16: 35,663,182 N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 T33M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 M1V probably null Het
Sorcs3 A G 19: 48,794,163 D1039G probably benign Het
Spon1 A G 7: 114,039,867 E776G probably damaging Het
Tdp1 C T 12: 99,902,364 A259V possibly damaging Het
Tex46 C A 4: 136,610,680 P61Q probably benign Het
Tnr T A 1: 159,897,066 L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trim43c A T 9: 88,847,652 H383L possibly damaging Het
Trip6 A G 5: 137,310,171 C439R probably damaging Het
Tsen2 C T 6: 115,575,933 S398L possibly damaging Het
Tubgcp2 T C 7: 139,996,161 D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc5c A T 3: 141,828,517 E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 R323* probably null Het
Zan G A 5: 137,389,019 T4924I unknown Het
Zfp597 G T 16: 3,865,987 Q302K probably benign Het
Other mutations in Tpra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Tpra1 APN 6 88910408 splice site probably benign
IGL00819:Tpra1 APN 6 88909336 nonsense probably null
IGL01648:Tpra1 APN 6 88909671 splice site probably benign
IGL01810:Tpra1 APN 6 88909342 missense probably damaging 1.00
IGL02040:Tpra1 APN 6 88910182 missense possibly damaging 0.89
IGL02864:Tpra1 APN 6 88911886 missense probably damaging 1.00
R0528:Tpra1 UTSW 6 88910390 missense probably benign 0.12
R1555:Tpra1 UTSW 6 88910203 missense probably damaging 0.99
R1824:Tpra1 UTSW 6 88911823 missense probably benign
R4879:Tpra1 UTSW 6 88911709 missense probably damaging 1.00
R6074:Tpra1 UTSW 6 88911937 missense possibly damaging 0.93
R7017:Tpra1 UTSW 6 88908312 missense probably damaging 1.00
R7097:Tpra1 UTSW 6 88908294 missense probably damaging 1.00
R7122:Tpra1 UTSW 6 88908294 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGGTTTATACGTGGGCCTG -3'
(R):5'- ATTAGCATGCAGAGGCCTG -3'

Sequencing Primer
(F):5'- ATACGTGGGCCTGGAGGG -3'
(R):5'- GCCTGGCCATCACTCAC -3'
Posted On2015-12-29