Incidental Mutation 'R4774:Mettl2'
ID367782
Institutional Source Beutler Lab
Gene Symbol Mettl2
Ensembl Gene ENSMUSG00000020691
Gene Namemethyltransferase like 2
SynonymsD11Ertd768e, 2810438F06Rik, C130031G21Rik, PSENIP1
MMRRC Submission 042412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4774 (G1)
Quality Score199
Status Validated
Chromosome11
Chromosomal Location105126425-105140394 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 105126610 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021030]
Predicted Effect probably null
Transcript: ENSMUST00000021030
SMART Domains Protein: ENSMUSP00000021030
Gene: ENSMUSG00000020691

DomainStartEndE-ValueType
Pfam:Methyltransf_23 150 337 1.2e-18 PFAM
Pfam:Ubie_methyltran 164 300 1.2e-8 PFAM
Pfam:MTS 166 291 4.3e-6 PFAM
Pfam:Methyltransf_31 171 331 1.6e-14 PFAM
Pfam:Methyltransf_18 173 286 2e-7 PFAM
Pfam:Methyltransf_25 177 279 7.6e-12 PFAM
Pfam:Methyltransf_12 178 281 1.1e-18 PFAM
Pfam:Methyltransf_11 178 283 5.7e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136214
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced 3-methylcytidine (m3C) methyltransferases modification of tRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 I844V probably damaging Het
Acnat1 T A 4: 49,450,784 Y109F probably benign Het
Alox12b T C 11: 69,163,207 V205A probably benign Het
Apopt1 A G 12: 111,713,389 T33A possibly damaging Het
Arl6ip1 G A 7: 118,121,985 R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 N24K probably damaging Het
Bdh1 T C 16: 31,455,136 V209A possibly damaging Het
Blm A T 7: 80,463,848 C1234S probably damaging Het
Caml A G 13: 55,631,927 D271G possibly damaging Het
Capn11 T C 17: 45,633,080 D545G probably benign Het
Catspere1 T C 1: 177,937,738 noncoding transcript Het
Ccdc114 T A 7: 45,948,380 S571R probably damaging Het
Cep128 T C 12: 91,234,195 E347G probably damaging Het
Cngb3 A G 4: 19,415,713 T408A possibly damaging Het
Cog1 G A 11: 113,657,427 R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 H2122R probably benign Het
Ctu2 T G 8: 122,481,112 S26A probably benign Het
Dbf4 G A 5: 8,403,062 probably benign Het
Ddx23 A T 15: 98,647,235 D663E probably benign Het
Dpep2 T C 8: 105,990,756 T123A possibly damaging Het
Eed A G 7: 89,964,768 I274T probably damaging Het
Eif3b A G 5: 140,419,500 D47G probably benign Het
Epas1 T C 17: 86,805,758 V124A probably damaging Het
Fam129a A T 1: 151,715,694 D529V probably damaging Het
Fer1l6 T C 15: 58,577,949 L668P probably damaging Het
Fnip2 C A 3: 79,465,721 E1017* probably null Het
Gm43517 A T 12: 49,389,907 probably benign Het
Got1 A G 19: 43,502,906 probably null Het
H2-Eb2 T A 17: 34,334,401 V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 probably benign Het
Hpgd T C 8: 56,298,419 V94A probably damaging Het
Htra1 T A 7: 130,985,026 N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 S89R probably damaging Het
Immt C T 6: 71,852,736 T142I probably damaging Het
Itpkb C A 1: 180,418,194 P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 R304S probably benign Het
Lama5 A C 2: 180,185,941 L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 L418V probably null Het
Lrrc4b C A 7: 44,462,372 probably null Het
Lyst A G 13: 13,740,597 N3292S probably damaging Het
Mep1b A T 18: 21,086,184 I132F probably benign Het
Nmd3 T C 3: 69,745,236 L385S probably benign Het
Nol4 T C 18: 22,912,626 E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 I38T probably benign Het
Olfr723 T A 14: 49,929,269 I92F probably damaging Het
Olfr917 A G 9: 38,665,223 I207T probably benign Het
Pcnp A G 16: 56,017,159 probably benign Het
Pla2g6 A C 15: 79,287,618 C680G probably damaging Het
Plekha7 G T 7: 116,144,943 D661E probably damaging Het
Prim1 A T 10: 128,027,018 probably benign Het
Psg29 T A 7: 17,210,535 N323K probably benign Het
Ptrh2 G A 11: 86,690,007 R150H probably damaging Het
Rasa1 A G 13: 85,250,502 probably benign Het
Rasa3 T C 8: 13,577,501 D667G probably benign Het
Rnase2a T C 14: 51,255,744 N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 probably benign Het
Sbp T A 17: 23,945,244 N133K probably damaging Het
Scml4 A G 10: 42,957,747 probably benign Het
Sema5b T A 16: 35,663,182 N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 T33M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 M1V probably null Het
Sorcs3 A G 19: 48,794,163 D1039G probably benign Het
Spon1 A G 7: 114,039,867 E776G probably damaging Het
Tdp1 C T 12: 99,902,364 A259V possibly damaging Het
Tex46 C A 4: 136,610,680 P61Q probably benign Het
Tnr T A 1: 159,897,066 L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpra1 G A 6: 88,910,679 probably benign Het
Trim43c A T 9: 88,847,652 H383L possibly damaging Het
Trip6 A G 5: 137,310,171 C439R probably damaging Het
Tsen2 C T 6: 115,575,933 S398L possibly damaging Het
Tubgcp2 T C 7: 139,996,161 D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc5c A T 3: 141,828,517 E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 R323* probably null Het
Zan G A 5: 137,389,019 T4924I unknown Het
Zfp597 G T 16: 3,865,987 Q302K probably benign Het
Other mutations in Mettl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Mettl2 APN 11 105126522 missense probably benign 0.00
IGL01565:Mettl2 APN 11 105126538 missense probably benign 0.00
R0071:Mettl2 UTSW 11 105131642 splice site probably benign
R0726:Mettl2 UTSW 11 105126844 missense probably benign
R0990:Mettl2 UTSW 11 105137744 nonsense probably null
R1318:Mettl2 UTSW 11 105137771 nonsense probably null
R1699:Mettl2 UTSW 11 105139718 missense probably benign 0.02
R1885:Mettl2 UTSW 11 105131620 missense possibly damaging 0.94
R1907:Mettl2 UTSW 11 105126840 missense probably benign 0.00
R3706:Mettl2 UTSW 11 105139726 missense probably benign
R4396:Mettl2 UTSW 11 105126778 missense probably damaging 1.00
R4876:Mettl2 UTSW 11 105129068 missense probably damaging 0.99
R4955:Mettl2 UTSW 11 105137779 missense possibly damaging 0.92
R6463:Mettl2 UTSW 11 105132581 critical splice donor site probably null
R7058:Mettl2 UTSW 11 105128893 missense probably benign
X0025:Mettl2 UTSW 11 105139713 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGAGCTTCCCAATCACTTG -3'
(R):5'- CACGTTGTCCCTGTGAAAACC -3'

Sequencing Primer
(F):5'- AGTGACGCTACTTCCGGAAG -3'
(R):5'- GTTGTCCCTGTGAAAACCAAACGG -3'
Posted On2015-12-29