Incidental Mutation 'R4774:Lyst'
ID367788
Institutional Source Beutler Lab
Gene Symbol Lyst
Ensembl Gene ENSMUSG00000019726
Gene Namelysosomal trafficking regulator
SynonymsD13Sfk13
MMRRC Submission 042412-MU
Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R4774 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location13590397-13778803 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13740597 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 3292 (N3292S)
Ref Sequence ENSEMBL: ENSMUSP00000106188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110559]
Predicted Effect probably damaging
Transcript: ENSMUST00000110559
AA Change: N3292S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: N3292S

DomainStartEndE-ValueType
low complexity region 26 36 N/A INTRINSIC
low complexity region 72 82 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
low complexity region 1333 1344 N/A INTRINSIC
low complexity region 2295 2307 N/A INTRINSIC
low complexity region 2427 2445 N/A INTRINSIC
low complexity region 2534 2546 N/A INTRINSIC
Pfam:PH_BEACH 3006 3101 5.8e-25 PFAM
Beach 3118 3408 1.25e-193 SMART
Blast:Beach 3441 3478 9e-13 BLAST
WD40 3539 3579 5.75e-1 SMART
WD40 3591 3630 2.89e-5 SMART
WD40 3633 3676 1.38e0 SMART
WD40 3724 3765 1.27e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221717
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
MGI Phenotype Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 I844V probably damaging Het
Acnat1 T A 4: 49,450,784 Y109F probably benign Het
Alox12b T C 11: 69,163,207 V205A probably benign Het
Apopt1 A G 12: 111,713,389 T33A possibly damaging Het
Arl6ip1 G A 7: 118,121,985 R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 N24K probably damaging Het
Bdh1 T C 16: 31,455,136 V209A possibly damaging Het
Blm A T 7: 80,463,848 C1234S probably damaging Het
Caml A G 13: 55,631,927 D271G possibly damaging Het
Capn11 T C 17: 45,633,080 D545G probably benign Het
Catspere1 T C 1: 177,937,738 noncoding transcript Het
Ccdc114 T A 7: 45,948,380 S571R probably damaging Het
Cep128 T C 12: 91,234,195 E347G probably damaging Het
Cngb3 A G 4: 19,415,713 T408A possibly damaging Het
Cog1 G A 11: 113,657,427 R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 H2122R probably benign Het
Ctu2 T G 8: 122,481,112 S26A probably benign Het
Dbf4 G A 5: 8,403,062 probably benign Het
Ddx23 A T 15: 98,647,235 D663E probably benign Het
Dpep2 T C 8: 105,990,756 T123A possibly damaging Het
Eed A G 7: 89,964,768 I274T probably damaging Het
Eif3b A G 5: 140,419,500 D47G probably benign Het
Epas1 T C 17: 86,805,758 V124A probably damaging Het
Fam129a A T 1: 151,715,694 D529V probably damaging Het
Fer1l6 T C 15: 58,577,949 L668P probably damaging Het
Fnip2 C A 3: 79,465,721 E1017* probably null Het
Gm43517 A T 12: 49,389,907 probably benign Het
Got1 A G 19: 43,502,906 probably null Het
H2-Eb2 T A 17: 34,334,401 V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 probably benign Het
Hpgd T C 8: 56,298,419 V94A probably damaging Het
Htra1 T A 7: 130,985,026 N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 S89R probably damaging Het
Immt C T 6: 71,852,736 T142I probably damaging Het
Itpkb C A 1: 180,418,194 P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 R304S probably benign Het
Lama5 A C 2: 180,185,941 L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 L418V probably null Het
Lrrc4b C A 7: 44,462,372 probably null Het
Mep1b A T 18: 21,086,184 I132F probably benign Het
Mettl2 A G 11: 105,126,610 probably null Het
Nmd3 T C 3: 69,745,236 L385S probably benign Het
Nol4 T C 18: 22,912,626 E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 I38T probably benign Het
Olfr723 T A 14: 49,929,269 I92F probably damaging Het
Olfr917 A G 9: 38,665,223 I207T probably benign Het
Pcnp A G 16: 56,017,159 probably benign Het
Pla2g6 A C 15: 79,287,618 C680G probably damaging Het
Plekha7 G T 7: 116,144,943 D661E probably damaging Het
Prim1 A T 10: 128,027,018 probably benign Het
Psg29 T A 7: 17,210,535 N323K probably benign Het
Ptrh2 G A 11: 86,690,007 R150H probably damaging Het
Rasa1 A G 13: 85,250,502 probably benign Het
Rasa3 T C 8: 13,577,501 D667G probably benign Het
Rnase2a T C 14: 51,255,744 N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 probably benign Het
Sbp T A 17: 23,945,244 N133K probably damaging Het
Scml4 A G 10: 42,957,747 probably benign Het
Sema5b T A 16: 35,663,182 N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 T33M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 M1V probably null Het
Sorcs3 A G 19: 48,794,163 D1039G probably benign Het
Spon1 A G 7: 114,039,867 E776G probably damaging Het
Tdp1 C T 12: 99,902,364 A259V possibly damaging Het
Tex46 C A 4: 136,610,680 P61Q probably benign Het
Tnr T A 1: 159,897,066 L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpra1 G A 6: 88,910,679 probably benign Het
Trim43c A T 9: 88,847,652 H383L possibly damaging Het
Trip6 A G 5: 137,310,171 C439R probably damaging Het
Tsen2 C T 6: 115,575,933 S398L possibly damaging Het
Tubgcp2 T C 7: 139,996,161 D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc5c A T 3: 141,828,517 E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 R323* probably null Het
Zan G A 5: 137,389,019 T4924I unknown Het
Zfp597 G T 16: 3,865,987 Q302K probably benign Het
Other mutations in Lyst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Lyst APN 13 13648878 missense probably benign
IGL00474:Lyst APN 13 13643536 missense possibly damaging 0.48
IGL00484:Lyst APN 13 13709603 missense probably benign 0.02
IGL00492:Lyst APN 13 13678175 missense possibly damaging 0.54
IGL00807:Lyst APN 13 13650423 missense possibly damaging 0.91
IGL00949:Lyst APN 13 13635485 missense possibly damaging 0.87
IGL00952:Lyst APN 13 13678107 missense probably benign 0.05
IGL01305:Lyst APN 13 13678056 missense probably benign 0.01
IGL01317:Lyst APN 13 13670870 missense probably benign
IGL01419:Lyst APN 13 13635838 missense probably benign 0.00
IGL01445:Lyst APN 13 13651714 missense probably benign 0.00
IGL01690:Lyst APN 13 13743246 missense probably damaging 1.00
IGL01791:Lyst APN 13 13635302 missense probably damaging 1.00
IGL01809:Lyst APN 13 13637803 missense probably damaging 1.00
IGL01896:Lyst APN 13 13635577 missense probably benign 0.04
IGL01938:Lyst APN 13 13637424 missense possibly damaging 0.93
IGL01986:Lyst APN 13 13775627 critical splice donor site probably null
IGL02022:Lyst APN 13 13664044 nonsense probably null
IGL02044:Lyst APN 13 13712846 missense probably damaging 1.00
IGL02157:Lyst APN 13 13660956 missense probably benign
IGL02185:Lyst APN 13 13661093 nonsense probably null
IGL02215:Lyst APN 13 13660956 missense probably benign
IGL02245:Lyst APN 13 13660956 missense probably benign
IGL02246:Lyst APN 13 13660956 missense probably benign
IGL02247:Lyst APN 13 13660956 missense probably benign
IGL02297:Lyst APN 13 13638092 nonsense probably null
IGL02411:Lyst APN 13 13660956 missense probably benign
IGL02415:Lyst APN 13 13660956 missense probably benign
IGL02419:Lyst APN 13 13660956 missense probably benign
IGL02420:Lyst APN 13 13660956 missense probably benign
IGL02429:Lyst APN 13 13660956 missense probably benign
IGL02501:Lyst APN 13 13711645 missense probably benign 0.02
IGL02522:Lyst APN 13 13634705 missense possibly damaging 0.81
IGL02535:Lyst APN 13 13650342 missense probably benign 0.00
IGL02596:Lyst APN 13 13660956 missense probably benign
IGL02601:Lyst APN 13 13660956 missense probably benign
IGL02603:Lyst APN 13 13660956 missense probably benign
IGL02608:Lyst APN 13 13712754 missense probably damaging 0.98
IGL02622:Lyst APN 13 13681390 missense probably damaging 1.00
IGL02690:Lyst APN 13 13641125 missense possibly damaging 0.58
IGL02715:Lyst APN 13 13674320 splice site probably null
IGL02725:Lyst APN 13 13760827 missense probably damaging 1.00
IGL02729:Lyst APN 13 13674339 missense possibly damaging 0.81
IGL02729:Lyst APN 13 13746609 missense possibly damaging 0.95
IGL02820:Lyst APN 13 13638058 missense probably benign 0.03
IGL02945:Lyst APN 13 13761198 missense possibly damaging 0.48
IGL02981:Lyst APN 13 13634911 missense probably damaging 0.99
IGL03087:Lyst APN 13 13635056 missense probably damaging 1.00
IGL03149:Lyst APN 13 13681444 missense probably benign 0.14
IGL03158:Lyst APN 13 13651752 critical splice donor site probably null
IGL03226:Lyst APN 13 13709559 missense probably benign 0.01
IGL03242:Lyst APN 13 13656881 nonsense probably null
IGL03385:Lyst APN 13 13656980 nonsense probably null
50-cal UTSW 13 13708212 critical splice donor site probably null
charcoal UTSW 13 13696761 nonsense probably null
charlotte_gray UTSW 13 13602026 intron probably benign
charzard UTSW 13 13647083 nonsense probably null
grey_wolf UTSW 13 unclassified
lightspeed UTSW 13 13740536 missense possibly damaging 0.91
robin UTSW 13 13648802 nonsense probably null
sooty UTSW 13 unclassified
souris UTSW 13 13683224 unclassified probably benign
Swallow UTSW 13 13757422 missense probably benign 0.00
vulpix UTSW 13 13696794 splice site probably null
ANU22:Lyst UTSW 13 13678056 missense probably benign 0.01
IGL02835:Lyst UTSW 13 13661100 missense possibly damaging 0.82
P0031:Lyst UTSW 13 13664031 missense probably damaging 1.00
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0012:Lyst UTSW 13 13687694 missense probably benign 0.10
R0031:Lyst UTSW 13 13708156 missense probably benign 0.14
R0115:Lyst UTSW 13 13677952 missense probably benign 0.00
R0212:Lyst UTSW 13 13635985 missense possibly damaging 0.93
R0386:Lyst UTSW 13 13708214 splice site probably benign
R0393:Lyst UTSW 13 13647079 missense probably benign 0.01
R0415:Lyst UTSW 13 13711610 splice site probably benign
R0446:Lyst UTSW 13 13638048 missense probably benign 0.00
R0481:Lyst UTSW 13 13677952 missense probably benign 0.00
R0499:Lyst UTSW 13 13616713 missense probably damaging 1.00
R0506:Lyst UTSW 13 13638015 missense probably benign
R0530:Lyst UTSW 13 13757306 splice site probably benign
R0541:Lyst UTSW 13 13681293 missense probably benign 0.00
R0570:Lyst UTSW 13 13709386 missense probably benign 0.26
R0680:Lyst UTSW 13 13650341 missense probably benign 0.01
R0842:Lyst UTSW 13 13678241 nonsense probably null
R0848:Lyst UTSW 13 13634930 missense probably benign 0.00
R1014:Lyst UTSW 13 13634060 missense possibly damaging 0.49
R1205:Lyst UTSW 13 13680202 missense probably benign
R1251:Lyst UTSW 13 13634483 missense probably benign 0.00
R1304:Lyst UTSW 13 13751984 nonsense probably null
R1398:Lyst UTSW 13 13740536 missense possibly damaging 0.91
R1445:Lyst UTSW 13 13640054 missense possibly damaging 0.94
R1475:Lyst UTSW 13 13708212 critical splice donor site probably null
R1479:Lyst UTSW 13 13634482 missense probably benign 0.00
R1484:Lyst UTSW 13 13678190 missense probably benign 0.01
R1498:Lyst UTSW 13 13650375 missense possibly damaging 0.49
R1540:Lyst UTSW 13 13635101 missense possibly damaging 0.81
R1611:Lyst UTSW 13 13634897 missense probably damaging 0.97
R1653:Lyst UTSW 13 13635226 missense probably damaging 1.00
R1669:Lyst UTSW 13 13644087 missense possibly damaging 0.90
R1686:Lyst UTSW 13 13634705 missense possibly damaging 0.81
R1694:Lyst UTSW 13 13661161 missense probably damaging 0.98
R1747:Lyst UTSW 13 13757422 missense probably benign 0.00
R1793:Lyst UTSW 13 13647083 nonsense probably null
R1871:Lyst UTSW 13 13651712 missense probably benign 0.00
R1905:Lyst UTSW 13 13634134 missense probably benign
R1958:Lyst UTSW 13 13616618 missense probably damaging 1.00
R1969:Lyst UTSW 13 13730344 missense probably damaging 0.99
R2040:Lyst UTSW 13 13641222 missense probably benign 0.00
R2109:Lyst UTSW 13 13712820 missense possibly damaging 0.46
R2116:Lyst UTSW 13 13635701 missense probably damaging 0.99
R2121:Lyst UTSW 13 13660971 missense probably damaging 1.00
R2127:Lyst UTSW 13 13635262 missense probably damaging 1.00
R2187:Lyst UTSW 13 13709341 missense possibly damaging 0.61
R2238:Lyst UTSW 13 13743263 missense probably benign 0.41
R2258:Lyst UTSW 13 13637658 missense probably benign 0.00
R2292:Lyst UTSW 13 13740495 missense probably damaging 1.00
R2368:Lyst UTSW 13 13696663 missense probably damaging 0.96
R2908:Lyst UTSW 13 13669873 missense probably benign 0.03
R3001:Lyst UTSW 13 13696705 missense probably benign
R3002:Lyst UTSW 13 13696705 missense probably benign
R3024:Lyst UTSW 13 13658687 missense probably benign
R3113:Lyst UTSW 13 13669927 missense probably benign 0.12
R3406:Lyst UTSW 13 13635230 missense possibly damaging 0.56
R3972:Lyst UTSW 13 13706625 missense possibly damaging 0.67
R3978:Lyst UTSW 13 13634168 missense possibly damaging 0.82
R4032:Lyst UTSW 13 13616665 missense probably damaging 1.00
R4192:Lyst UTSW 13 13740513 missense probably damaging 1.00
R4206:Lyst UTSW 13 13635989 missense probably benign 0.03
R4298:Lyst UTSW 13 13634887 missense probably damaging 1.00
R4344:Lyst UTSW 13 13698466 missense probably benign 0.06
R4441:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4445:Lyst UTSW 13 13709564 missense probably benign 0.42
R4477:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4493:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4494:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4495:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4622:Lyst UTSW 13 13674398 missense probably benign 0.01
R4638:Lyst UTSW 13 13696794 splice site probably null
R4658:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4675:Lyst UTSW 13 13635383 missense probably damaging 1.00
R4719:Lyst UTSW 13 13650350 missense probably benign
R4729:Lyst UTSW 13 13637901 missense probably damaging 1.00
R4811:Lyst UTSW 13 13777100 missense probably benign 0.33
R4877:Lyst UTSW 13 13683149 missense probably damaging 1.00
R4920:Lyst UTSW 13 13647060 missense possibly damaging 0.79
R4933:Lyst UTSW 13 13637764 missense probably damaging 0.98
R4933:Lyst UTSW 13 13759378 missense probably benign 0.12
R4958:Lyst UTSW 13 13635463 missense probably benign 0.00
R4982:Lyst UTSW 13 13725954 missense probably damaging 1.00
R4992:Lyst UTSW 13 13661163 missense probably damaging 1.00
R5024:Lyst UTSW 13 13634404 missense probably benign
R5049:Lyst UTSW 13 13636064 missense probably damaging 1.00
R5079:Lyst UTSW 13 13757353 missense probably benign 0.08
R5254:Lyst UTSW 13 13683070 missense probably benign 0.00
R5266:Lyst UTSW 13 13660970 missense probably damaging 1.00
R5279:Lyst UTSW 13 13648802 nonsense probably null
R5285:Lyst UTSW 13 13634426 missense probably benign 0.01
R5364:Lyst UTSW 13 13656854 missense probably benign 0.35
R5435:Lyst UTSW 13 13777064 missense possibly damaging 0.64
R5516:Lyst UTSW 13 13644122 missense probably benign 0.10
R5524:Lyst UTSW 13 13746779 missense probably benign 0.03
R5591:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5592:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5593:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13743333 missense probably damaging 0.99
R5594:Lyst UTSW 13 13759397 missense probably benign 0.00
R5644:Lyst UTSW 13 13637496 missense possibly damaging 0.58
R5659:Lyst UTSW 13 13634627 missense possibly damaging 0.58
R5741:Lyst UTSW 13 13634030 missense probably benign 0.44
R5908:Lyst UTSW 13 13696761 nonsense probably null
R5969:Lyst UTSW 13 13687813 splice site probably null
R6128:Lyst UTSW 13 13759379 missense possibly damaging 0.67
R6271:Lyst UTSW 13 13658754 missense probably benign 0.30
R6315:Lyst UTSW 13 13643504 missense probably benign
R6318:Lyst UTSW 13 13743311 missense possibly damaging 0.88
R6555:Lyst UTSW 13 13648925 missense probably benign 0.01
R6663:Lyst UTSW 13 13664116 splice site probably null
R6701:Lyst UTSW 13 13681485 missense probably benign 0.06
R6711:Lyst UTSW 13 13635235 missense possibly damaging 0.80
R6909:Lyst UTSW 13 13743375 missense probably damaging 1.00
R6915:Lyst UTSW 13 13726044 missense probably benign 0.01
R6929:Lyst UTSW 13 13743324 missense probably damaging 1.00
R6960:Lyst UTSW 13 13634078 missense probably benign 0.12
X0024:Lyst UTSW 13 13634448 missense probably benign 0.00
X0026:Lyst UTSW 13 13751970 missense probably damaging 0.99
Z1088:Lyst UTSW 13 13743433 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTGCTACGGGAAGCTTCAAG -3'
(R):5'- CCAGTCCTCGGTCCTATAAAATTTTAG -3'

Sequencing Primer
(F):5'- GAAGCTTCAAGTGGAATATGGTC -3'
(R):5'- TTTTAGAAGTCCCCAAGCTCACCTAG -3'
Posted On2015-12-29