Incidental Mutation 'R4774:Olfr723'
ID367792
Institutional Source Beutler Lab
Gene Symbol Olfr723
Ensembl Gene ENSMUSG00000093825
Gene Nameolfactory receptor 723
SynonymsGA_x6K02T2PMLR-5600424-5599495, MOR247-4, MOR247-3P
MMRRC Submission 042412-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4774 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location49928563-49931787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49929269 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 92 (I92F)
Ref Sequence ENSEMBL: ENSMUSP00000145863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164157] [ENSMUST00000206058]
Predicted Effect probably damaging
Transcript: ENSMUST00000164157
AA Change: I92F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129254
Gene: ENSMUSG00000093825
AA Change: I92F

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 1.8e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 302 1.4e-12 PFAM
Pfam:7tm_1 41 287 4.8e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206058
AA Change: I92F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (97/99)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,639,317 I844V probably damaging Het
Acnat1 T A 4: 49,450,784 Y109F probably benign Het
Alox12b T C 11: 69,163,207 V205A probably benign Het
Apopt1 A G 12: 111,713,389 T33A possibly damaging Het
Arl6ip1 G A 7: 118,121,985 R77C probably damaging Het
Atp8b1 A G 18: 64,533,659 C1156R possibly damaging Het
Atp8b3 A C 10: 80,536,322 N24K probably damaging Het
Bdh1 T C 16: 31,455,136 V209A possibly damaging Het
Blm A T 7: 80,463,848 C1234S probably damaging Het
Caml A G 13: 55,631,927 D271G possibly damaging Het
Capn11 T C 17: 45,633,080 D545G probably benign Het
Catspere1 T C 1: 177,937,738 noncoding transcript Het
Ccdc114 T A 7: 45,948,380 S571R probably damaging Het
Cep128 T C 12: 91,234,195 E347G probably damaging Het
Cngb3 A G 4: 19,415,713 T408A possibly damaging Het
Cog1 G A 11: 113,657,427 R18Q possibly damaging Het
Cps1 T C 1: 67,220,512 F1338L probably damaging Het
Csmd1 T C 8: 16,009,369 H2122R probably benign Het
Ctu2 T G 8: 122,481,112 S26A probably benign Het
Dbf4 G A 5: 8,403,062 probably benign Het
Ddx23 A T 15: 98,647,235 D663E probably benign Het
Dpep2 T C 8: 105,990,756 T123A possibly damaging Het
Eed A G 7: 89,964,768 I274T probably damaging Het
Eif3b A G 5: 140,419,500 D47G probably benign Het
Epas1 T C 17: 86,805,758 V124A probably damaging Het
Fam129a A T 1: 151,715,694 D529V probably damaging Het
Fer1l6 T C 15: 58,577,949 L668P probably damaging Het
Fnip2 C A 3: 79,465,721 E1017* probably null Het
Gm43517 A T 12: 49,389,907 probably benign Het
Got1 A G 19: 43,502,906 probably null Het
H2-Eb2 T A 17: 34,334,401 V187E probably damaging Het
H2-Q1 T C 17: 35,321,266 probably benign Het
Hpgd T C 8: 56,298,419 V94A probably damaging Het
Htra1 T A 7: 130,985,026 N446K probably benign Het
Igkv3-4 T A 6: 70,672,285 S89R probably damaging Het
Immt C T 6: 71,852,736 T142I probably damaging Het
Itpkb C A 1: 180,418,194 P759T probably damaging Het
Jmjd1c G A 10: 67,224,792 V688I possibly damaging Het
Kbtbd13 G T 9: 65,390,743 R304S probably benign Het
Lama5 A C 2: 180,185,941 L2176R probably damaging Het
Lrp1b G C 2: 40,661,532 L418V probably null Het
Lrrc4b C A 7: 44,462,372 probably null Het
Lyst A G 13: 13,740,597 N3292S probably damaging Het
Mep1b A T 18: 21,086,184 I132F probably benign Het
Mettl2 A G 11: 105,126,610 probably null Het
Nmd3 T C 3: 69,745,236 L385S probably benign Het
Nol4 T C 18: 22,912,626 E243G probably damaging Het
Olfr1052 A T 2: 86,298,698 N294I possibly damaging Het
Olfr639 A G 7: 104,012,588 I38T probably benign Het
Olfr917 A G 9: 38,665,223 I207T probably benign Het
Pcnp A G 16: 56,017,159 probably benign Het
Pla2g6 A C 15: 79,287,618 C680G probably damaging Het
Plekha7 G T 7: 116,144,943 D661E probably damaging Het
Prim1 A T 10: 128,027,018 probably benign Het
Psg29 T A 7: 17,210,535 N323K probably benign Het
Ptrh2 G A 11: 86,690,007 R150H probably damaging Het
Rasa1 A G 13: 85,250,502 probably benign Het
Rasa3 T C 8: 13,577,501 D667G probably benign Het
Rnase2a T C 14: 51,255,744 N55D probably damaging Het
Rsf1 GCGGCGGCGGCGGCGGCGGC GCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,916 probably benign Het
Sbp T A 17: 23,945,244 N133K probably damaging Het
Scml4 A G 10: 42,957,747 probably benign Het
Sema5b T A 16: 35,663,182 N1063K probably damaging Het
Serpind1 C T 16: 17,336,408 T33M probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc15a2 A T 16: 36,781,695 L80* probably null Het
Slc9a3r2 T C 17: 24,644,899 M1V probably null Het
Sorcs3 A G 19: 48,794,163 D1039G probably benign Het
Spon1 A G 7: 114,039,867 E776G probably damaging Het
Tdp1 C T 12: 99,902,364 A259V possibly damaging Het
Tex46 C A 4: 136,610,680 P61Q probably benign Het
Tnr T A 1: 159,897,066 L1109Q probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpra1 G A 6: 88,910,679 probably benign Het
Trim43c A T 9: 88,847,652 H383L possibly damaging Het
Trip6 A G 5: 137,310,171 C439R probably damaging Het
Tsen2 C T 6: 115,575,933 S398L possibly damaging Het
Tubgcp2 T C 7: 139,996,161 D863G probably damaging Het
Ube2d2a A G 18: 35,770,445 probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc5c A T 3: 141,828,517 E933V probably damaging Het
Vmn1r208 A G 13: 22,772,476 F284L probably benign Het
Vmn2r53 T A 7: 12,600,765 R323* probably null Het
Zan G A 5: 137,389,019 T4924I unknown Het
Zfp597 G T 16: 3,865,987 Q302K probably benign Het
Other mutations in Olfr723
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01968:Olfr723 APN 14 49929098 missense probably damaging 1.00
IGL02481:Olfr723 APN 14 49928707 missense probably damaging 1.00
IGL03269:Olfr723 APN 14 49928708 missense probably damaging 1.00
IGL03330:Olfr723 APN 14 49929221 missense probably damaging 1.00
R1782:Olfr723 UTSW 14 49928639 missense probably benign
R2061:Olfr723 UTSW 14 49929021 missense possibly damaging 0.78
R3014:Olfr723 UTSW 14 49929032 missense probably benign 0.00
R4134:Olfr723 UTSW 14 49928815 missense probably damaging 1.00
R4135:Olfr723 UTSW 14 49928815 missense probably damaging 1.00
R4212:Olfr723 UTSW 14 49928889 nonsense probably null
R4951:Olfr723 UTSW 14 49929058 nonsense probably null
R4965:Olfr723 UTSW 14 49928897 missense probably benign 0.01
R5254:Olfr723 UTSW 14 49928779 missense probably damaging 0.99
R5306:Olfr723 UTSW 14 49929550 start gained probably benign
R5502:Olfr723 UTSW 14 49929536 missense probably benign
R5799:Olfr723 UTSW 14 49929040 missense probably damaging 1.00
R6062:Olfr723 UTSW 14 49928662 missense probably damaging 1.00
R6072:Olfr723 UTSW 14 49929149 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGAAACCAATTGTCCAGGAAAGG -3'
(R):5'- TTTCCGGAAACTGGCAACTTC -3'

Sequencing Primer
(F):5'- CCAGGAAAGGATAATAAACCTGTTC -3'
(R):5'- CCGGAAACTGGCAACTTCAAATTTTC -3'
Posted On2015-12-29