Incidental Mutation 'R4775:Stkld1'
ID367823
Institutional Source Beutler Lab
Gene Symbol Stkld1
Ensembl Gene ENSMUSG00000049897
Gene Nameserine/threonine kinase-like domain containing 1
SynonymsLOC279029, Gm711
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26934047-26953496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26951745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 543 (V543E)
Ref Sequence ENSEMBL: ENSMUSP00000062967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055406] [ENSMUST00000064244] [ENSMUST00000114020] [ENSMUST00000136710]
Predicted Effect probably damaging
Transcript: ENSMUST00000055406
AA Change: V543E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062967
Gene: ENSMUSG00000049897
AA Change: V543E

DomainStartEndE-ValueType
Pfam:Pkinase 3 266 8e-35 PFAM
Pfam:Pkinase_Tyr 7 262 4.5e-27 PFAM
low complexity region 352 366 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064244
SMART Domains Protein: ENSMUSP00000070815
Gene: ENSMUSG00000052406

DomainStartEndE-ValueType
low complexity region 16 34 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
EXOIII 229 390 2.55e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114020
SMART Domains Protein: ENSMUSP00000109653
Gene: ENSMUSG00000052406

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
low complexity region 203 220 N/A INTRINSIC
EXOIII 252 413 2.55e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135752
Predicted Effect probably benign
Transcript: ENSMUST00000136710
SMART Domains Protein: ENSMUSP00000121599
Gene: ENSMUSG00000052406

DomainStartEndE-ValueType
low complexity region 16 34 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
EXOIII 229 363 1.57e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145546
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Stkld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Stkld1 APN 2 26951471 missense probably benign 0.01
IGL02183:Stkld1 APN 2 26946659 missense probably benign 0.04
IGL02393:Stkld1 APN 2 26950142 missense probably benign 0.41
IGL03136:Stkld1 APN 2 26951423 missense probably benign 0.00
IGL03261:Stkld1 APN 2 26952777 missense probably benign 0.21
R0067:Stkld1 UTSW 2 26949340 missense probably benign 0.01
R0067:Stkld1 UTSW 2 26949340 missense probably benign 0.01
R0973:Stkld1 UTSW 2 26951450 missense probably benign 0.00
R1065:Stkld1 UTSW 2 26940038 missense probably damaging 0.97
R1467:Stkld1 UTSW 2 26949395 missense probably benign 0.00
R1467:Stkld1 UTSW 2 26949395 missense probably benign 0.00
R1565:Stkld1 UTSW 2 26950090 missense probably benign 0.00
R1844:Stkld1 UTSW 2 26950103 missense probably damaging 1.00
R1871:Stkld1 UTSW 2 26937973 unclassified probably benign
R1965:Stkld1 UTSW 2 26946732 unclassified probably null
R2001:Stkld1 UTSW 2 26952747 missense probably damaging 1.00
R2308:Stkld1 UTSW 2 26952714 missense probably damaging 0.98
R2566:Stkld1 UTSW 2 26950638 missense probably damaging 1.00
R3929:Stkld1 UTSW 2 26940047 critical splice donor site probably null
R4257:Stkld1 UTSW 2 26943134 missense probably benign 0.02
R4493:Stkld1 UTSW 2 26946626 missense probably benign 0.00
R4494:Stkld1 UTSW 2 26946626 missense probably benign 0.00
R4589:Stkld1 UTSW 2 26950667 missense probably damaging 1.00
R5601:Stkld1 UTSW 2 26952705 missense probably damaging 1.00
R5707:Stkld1 UTSW 2 26943987 missense probably damaging 1.00
R6259:Stkld1 UTSW 2 26949381 missense possibly damaging 0.70
R6306:Stkld1 UTSW 2 26943887 missense probably damaging 0.98
R6349:Stkld1 UTSW 2 26945860 missense probably benign 0.00
R6418:Stkld1 UTSW 2 26941081 missense possibly damaging 0.47
R6806:Stkld1 UTSW 2 26943910 missense probably benign 0.01
R7079:Stkld1 UTSW 2 26949347 missense probably benign 0.00
R7199:Stkld1 UTSW 2 26952714 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAAAGAGCCCTTGGAGCAG -3'
(R):5'- GGAGACTCATGTGGCTATAGG -3'

Sequencing Primer
(F):5'- AGCTCTCTGGCATGGTCAC -3'
(R):5'- AGACTCATGTGGCTATAGGATGTG -3'
Posted On2015-12-29