Incidental Mutation 'R4775:Nelfcd'
ID367826
Institutional Source Beutler Lab
Gene Symbol Nelfcd
Ensembl Gene ENSMUSG00000016253
Gene Namenegative elongation factor complex member C/D, Th1l
Synonymstrihydrophobin 1, Th1l, 2410003I03Rik
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #R4775 (G1)
Quality Score129
Status Not validated
Chromosome2
Chromosomal Location174415804-174427502 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 174426576 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 520 (C520G)
Ref Sequence ENSEMBL: ENSMUSP00000104703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect possibly damaging
Transcript: ENSMUST00000016397
AA Change: C536G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253
AA Change: C536G

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016400
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109075
AA Change: C520G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253
AA Change: C520G

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143683
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by this gene is an essential part of the NELF complex. Alternative translation initiation site usage results in the formation of two isoforms with different N-termini. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Nelfcd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Nelfcd APN 2 174423515 splice site probably benign
IGL02175:Nelfcd APN 2 174420382 missense probably benign 0.01
IGL02955:Nelfcd APN 2 174422598 missense probably damaging 0.98
IGL03193:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03194:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03203:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03217:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03237:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03273:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03278:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03289:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03365:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03398:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03405:Nelfcd APN 2 174426832 missense possibly damaging 0.87
IGL03407:Nelfcd APN 2 174426832 missense possibly damaging 0.87
R0593:Nelfcd UTSW 2 174423430 missense probably benign 0.00
R0751:Nelfcd UTSW 2 174423014 missense probably benign 0.03
R1852:Nelfcd UTSW 2 174423978 splice site probably null
R2040:Nelfcd UTSW 2 174420082 missense probably damaging 1.00
R3606:Nelfcd UTSW 2 174426544 missense probably benign 0.10
R3716:Nelfcd UTSW 2 174423005 missense possibly damaging 0.51
R4235:Nelfcd UTSW 2 174427048 missense probably damaging 1.00
R4607:Nelfcd UTSW 2 174423162 missense probably benign 0.01
R5104:Nelfcd UTSW 2 174426366 missense probably benign 0.10
R5859:Nelfcd UTSW 2 174427063 makesense probably null
R6025:Nelfcd UTSW 2 174426818 missense probably damaging 1.00
R6104:Nelfcd UTSW 2 174423457 missense probably damaging 0.99
R6280:Nelfcd UTSW 2 174415946 missense probably benign
R7249:Nelfcd UTSW 2 174423206 critical splice donor site probably null
Z1088:Nelfcd UTSW 2 174426494 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGAGACAGAGCACTCCCAG -3'
(R):5'- GACCGCACTCCATAATAGTCAGG -3'

Sequencing Primer
(F):5'- ACTCCCAGCTAGACGTGATG -3'
(R):5'- CACTCCATAATAGTCAGGGAGGTGTG -3'
Posted On2015-12-29