Incidental Mutation 'R4775:Tars2'
ID367829
Institutional Source Beutler Lab
Gene Symbol Tars2
Ensembl Gene ENSMUSG00000028107
Gene Namethreonyl-tRNA synthetase 2, mitochondrial (putative)
SynonymsTarsl1, 2610024N01Rik
MMRRC Submission 041991-MU
Accession Numbers

Genbank: NM_027931.3, NM_001163617.1, NM_001163618.1, NM_001163619.1; Ensembl: ENSMUST00000029752, ENSMUST00000074339 , ENSMUST00000098857, ENSMUST00000163530

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4775 (G1)
Quality Score128
Status Not validated
Chromosome3
Chromosomal Location95739976-95760206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95746647 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 354 (L354P)
Ref Sequence ENSEMBL: ENSMUSP00000130269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000074339] [ENSMUST00000098857] [ENSMUST00000163530] [ENSMUST00000195929] [ENSMUST00000196077] [ENSMUST00000196868] [ENSMUST00000197720] [ENSMUST00000198289] [ENSMUST00000199464] [ENSMUST00000199570]
Predicted Effect probably damaging
Transcript: ENSMUST00000029752
AA Change: L435P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107
AA Change: L435P

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000074339
AA Change: L435P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107
AA Change: L435P

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098857
SMART Domains Protein: ENSMUSP00000096456
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 6.7e-16 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
SCOP:d1atia2 332 417 2e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163530
AA Change: L354P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107
AA Change: L354P

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195929
SMART Domains Protein: ENSMUSP00000143757
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:tRNA_SAD 1 28 3.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196475
Predicted Effect probably benign
Transcript: ENSMUST00000196868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197389
Predicted Effect probably benign
Transcript: ENSMUST00000197720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198194
Predicted Effect probably benign
Transcript: ENSMUST00000198289
SMART Domains Protein: ENSMUSP00000143271
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
tRNA_SAD 2 43 2.6e-8 SMART
Pfam:tRNA-synt_2b 97 142 6.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199570
SMART Domains Protein: ENSMUSP00000143038
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.5e-13 PFAM
tRNA_SAD 152 201 8.5e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200376
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the class-II aminoacyl-tRNA synthetase family. The encoded protein is a mitochondrial aminoacyl-tRNA synthetase. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 4. [provided by RefSeq, Dec 2012]
Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Tars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Tars2 APN 3 95740278 missense probably damaging 1.00
IGL02523:Tars2 APN 3 95741393 missense probably damaging 1.00
IGL02709:Tars2 APN 3 95742071 splice site probably benign
IGL03286:Tars2 APN 3 95754755 splice site probably benign
IGL03348:Tars2 APN 3 95740268 unclassified probably null
B6584:Tars2 UTSW 3 95742150 unclassified probably null
R0548:Tars2 UTSW 3 95742659 missense probably damaging 1.00
R0657:Tars2 UTSW 3 95748557 missense probably benign 0.00
R1955:Tars2 UTSW 3 95747454 missense probably damaging 1.00
R2070:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R2071:Tars2 UTSW 3 95747638 missense probably damaging 1.00
R3025:Tars2 UTSW 3 95747640 missense possibly damaging 0.71
R3962:Tars2 UTSW 3 95754756 critical splice donor site probably null
R4676:Tars2 UTSW 3 95753091 missense probably damaging 1.00
R5208:Tars2 UTSW 3 95747593 missense probably damaging 1.00
R5512:Tars2 UTSW 3 95750416 missense probably damaging 1.00
R5894:Tars2 UTSW 3 95747652 unclassified probably null
R5965:Tars2 UTSW 3 95748152 splice site probably null
R6381:Tars2 UTSW 3 95754487 nonsense probably null
R6953:Tars2 UTSW 3 95753114 missense possibly damaging 0.63
R7042:Tars2 UTSW 3 95750745 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACTAGGGCCTGTGGATAAATC -3'
(R):5'- CTAGGATTGCAGAGAAAGTGGATACTC -3'

Sequencing Primer
(F):5'- CCTGTGGATAAATCTGGCTAGCAC -3'
(R):5'- TGGCACACAGCTGTAATCTCAG -3'
Posted On2015-12-29