Incidental Mutation 'R4775:Dvl1'
ID367833
Institutional Source Beutler Lab
Gene Symbol Dvl1
Ensembl Gene ENSMUSG00000029071
Gene Namedishevelled segment polarity protein 1
Synonyms
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4775 (G1)
Quality Score207
Status Not validated
Chromosome4
Chromosomal Location155847402-155859303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155858127 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 617 (W617R)
Ref Sequence ENSEMBL: ENSMUSP00000133137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030948] [ENSMUST00000030949] [ENSMUST00000168552]
Predicted Effect probably benign
Transcript: ENSMUST00000030948
AA Change: W617R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071
AA Change: W617R

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030949
SMART Domains Protein: ENSMUSP00000030949
Gene: ENSMUSG00000029072

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 72 469 2e-79 PFAM
Pfam:NCD3G 500 552 1.9e-16 PFAM
Pfam:7tm_3 576 821 9.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141539
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156997
Predicted Effect probably benign
Transcript: ENSMUST00000168552
AA Change: W617R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071
AA Change: W617R

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the Dishevelled family of proteins. These proteins have an N-terminal Dishevelled/Axin domain, a Dishevelled, EGL-10, Plextrin domain, a central PDZ domain, and a C-terminal domain of approximately 200 amino acids. They regulate both canonical and non-canonical Wnt signaling as well as planar cell polarity pathways. Mice deficient for this gene are viable and fertile but display reduced social interaction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygous targeted mutants are viable and fertile, but show a number of behavioral changes including deficient nest-building, less huddling contact during sleep, reduced subordinate responses, and other social interaction deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Dvl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Dvl1 APN 4 155853698 missense possibly damaging 0.85
IGL01930:Dvl1 APN 4 155856188 missense possibly damaging 0.72
IGL02499:Dvl1 APN 4 155854780 missense probably benign 0.10
IGL03075:Dvl1 APN 4 155854583 missense probably damaging 0.99
IGL03089:Dvl1 APN 4 155855152 missense probably damaging 1.00
R0525:Dvl1 UTSW 4 155855595 missense probably damaging 0.99
R0624:Dvl1 UTSW 4 155854775 missense probably damaging 1.00
R0633:Dvl1 UTSW 4 155858295 missense probably damaging 1.00
R1459:Dvl1 UTSW 4 155854019 missense probably damaging 0.99
R1955:Dvl1 UTSW 4 155858029 missense possibly damaging 0.69
R1991:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2144:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2145:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2156:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2191:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2192:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2290:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2292:Dvl1 UTSW 4 155847816 missense possibly damaging 0.84
R2304:Dvl1 UTSW 4 155855584 missense probably damaging 0.98
R2519:Dvl1 UTSW 4 155855543 nonsense probably null
R3082:Dvl1 UTSW 4 155847859 missense possibly damaging 0.92
R3110:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R3112:Dvl1 UTSW 4 155853666 missense probably damaging 0.98
R5384:Dvl1 UTSW 4 155853686 missense probably damaging 0.99
R6148:Dvl1 UTSW 4 155854952 missense probably damaging 1.00
R6563:Dvl1 UTSW 4 155856253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATCTCCAGGCTTACCAG -3'
(R):5'- TGTAAGTTCTGGAGGGACAGC -3'

Sequencing Primer
(F):5'- TCCAGGCTTACCAGGTCCTG -3'
(R):5'- CTGGAGGGACAGCAGCCAG -3'
Posted On2015-12-29