Incidental Mutation 'R4775:Ccdc174'
ID367836
Institutional Source Beutler Lab
Gene Symbol Ccdc174
Ensembl Gene ENSMUSG00000034083
Gene Namecoiled-coil domain containing 174
Synonyms
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location91878053-91899843 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 91890894 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037783] [ENSMUST00000136090]
Predicted Effect probably null
Transcript: ENSMUST00000037783
SMART Domains Protein: ENSMUSP00000049280
Gene: ENSMUSG00000034083

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
coiled coil region 64 98 N/A INTRINSIC
low complexity region 137 152 N/A INTRINSIC
Pfam:DUF4078 215 303 4.4e-32 PFAM
low complexity region 323 340 N/A INTRINSIC
low complexity region 423 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151378
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the nucleus, where it interacts with eukaryotic translation initiation factor 4A, isoform 3. The encoded protein appears to be a part of the exon junction complex, which is involved in RNA processing, translation, and nonsense-mediated mRNA decay. A mutation in this gene has been associated with infantile hypotonia with psychomotor retardation. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption may exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Ccdc174
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Ccdc174 APN 6 91880362 critical splice donor site probably null
IGL02391:Ccdc174 APN 6 91898282 missense possibly damaging 0.72
IGL02619:Ccdc174 APN 6 91899557 missense possibly damaging 0.70
IGL02698:Ccdc174 APN 6 91890853 missense probably benign
R0482:Ccdc174 UTSW 6 91895266 missense probably benign 0.08
R0612:Ccdc174 UTSW 6 91890892 splice site probably benign
R0801:Ccdc174 UTSW 6 91895332 missense possibly damaging 0.72
R1124:Ccdc174 UTSW 6 91899580 missense probably benign 0.33
R1237:Ccdc174 UTSW 6 91890787 splice site probably benign
R1388:Ccdc174 UTSW 6 91881244 splice site probably null
R2176:Ccdc174 UTSW 6 91888089 missense probably benign 0.01
R3914:Ccdc174 UTSW 6 91899357 missense possibly damaging 0.70
R4342:Ccdc174 UTSW 6 91885356 nonsense probably null
R4880:Ccdc174 UTSW 6 91899591 unclassified probably benign
R5579:Ccdc174 UTSW 6 91881350 splice site probably null
R5787:Ccdc174 UTSW 6 91881310 nonsense probably null
R5869:Ccdc174 UTSW 6 91885418 utr 3 prime probably benign
R6277:Ccdc174 UTSW 6 91880291 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTGAGTCTCAGCTGCTGG -3'
(R):5'- AGGTTGTTCCCTGAGCACAG -3'

Sequencing Primer
(F):5'- GGTCCCTTAGCTGCAAGGTTC -3'
(R):5'- GTTCCCTGAGCACAGAAGATTATG -3'
Posted On2015-12-29