Incidental Mutation 'R4775:Cidec'
ID367838
Institutional Source Beutler Lab
Gene Symbol Cidec
Ensembl Gene ENSMUSG00000030278
Gene Namecell death-inducing DFFA-like effector c
SynonymsCIDE-3alpha, CIDE-3, Fsp27
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R4775 (G1)
Quality Score135
Status Not validated
Chromosome6
Chromosomal Location113424634-113435760 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 113434734 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000108714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032416] [ENSMUST00000113089] [ENSMUST00000113091] [ENSMUST00000133348]
Predicted Effect probably benign
Transcript: ENSMUST00000032416
SMART Domains Protein: ENSMUSP00000032416
Gene: ENSMUSG00000030278

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
CAD 43 116 7.93e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113089
SMART Domains Protein: ENSMUSP00000108712
Gene: ENSMUSG00000030278

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
CAD 43 116 7.93e-49 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113091
AA Change: M1V

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108714
Gene: ENSMUSG00000030278
AA Change: M1V

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
CAD 53 126 7.93e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133348
SMART Domains Protein: ENSMUSP00000122068
Gene: ENSMUSG00000030278

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:CIDE-N 41 83 2.1e-16 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cell death-inducing DNA fragmentation factor-like effector family. Members of this family play important roles in apoptosis. The encoded protein promotes lipid droplet formation in adipocytes and may mediate adipocyte apoptosis. This gene is regulated by insulin and its expression is positively correlated with insulin sensitivity. Mutations in this gene may contribute to insulin resistant diabetes. A pseudogene of this gene is located on the short arm of chromosome 3. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Nullizygous mice exhibit leaness, high energy expenditure, improved glucose tolerance, altered brown adipocytes, and multilocular fat droplets with enhanced mitochondrial activity and lipolysis in white adipocytes, and may show resistance to age related and diet-induced obesity and liver steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Cidec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03261:Cidec APN 6 113433172 missense probably benign 0.13
R1994:Cidec UTSW 6 113428232 missense probably damaging 1.00
R2079:Cidec UTSW 6 113425654 missense probably benign 0.00
R3121:Cidec UTSW 6 113428125 missense probably benign
R4560:Cidec UTSW 6 113428438 missense probably damaging 1.00
R5513:Cidec UTSW 6 113428179 missense probably damaging 1.00
R5906:Cidec UTSW 6 113428321 splice site probably null
R7287:Cidec UTSW 6 113428398 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGGACCTAGAACACAGGC -3'
(R):5'- TCTGGACTATAGGTGACTTTCAGG -3'

Sequencing Primer
(F):5'- CAGGCAGAAGCTTATCTGGTTAGC -3'
(R):5'- GGTGACTTTCAGGTCCCTCACAG -3'
Posted On2015-12-29