Incidental Mutation 'R4775:C5ar2'
ID367842
Institutional Source Beutler Lab
Gene Symbol C5ar2
Ensembl Gene ENSMUSG00000074361
Gene Namecomplement component 5a receptor 2
SynonymsGpr77, C5L2, E030029A11Rik
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #R4775 (G1)
Quality Score224
Status Not validated
Chromosome7
Chromosomal Location16234585-16244154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 16237615 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 129 (L129R)
Ref Sequence ENSEMBL: ENSMUSP00000133056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098792] [ENSMUST00000171425]
Predicted Effect probably damaging
Transcript: ENSMUST00000098792
AA Change: L129R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096389
Gene: ENSMUSG00000074361
AA Change: L129R

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 68 N/A INTRINSIC
Pfam:7tm_1 72 311 9.5e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116763
Predicted Effect probably damaging
Transcript: ENSMUST00000171425
AA Change: L129R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133056
Gene: ENSMUSG00000074361
AA Change: L129R

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
low complexity region 53 68 N/A INTRINSIC
Pfam:7tm_1 72 257 7e-21 PFAM
Pfam:7tm_1 243 311 8.2e-7 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor 1 family member involved in the complement system of the innate immune response. Unlike classical G-protein coupled receptors, the encoded protein does not associate with intracellular G-proteins. It may instead modulate signal transduction through the beta-arrestin pathway, and may alternatively act as a decoy receptor. This gene may be involved in coronary artery disease and in the pathogenesis of sepsis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice display increased inflammatory response and chemotaxis after exposure to anaphylatoxins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in C5ar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0021:C5ar2 UTSW 7 16237676 missense probably benign 0.00
R0848:C5ar2 UTSW 7 16237601 missense probably benign 0.35
R3078:C5ar2 UTSW 7 16237424 missense probably damaging 1.00
R5549:C5ar2 UTSW 7 16236943 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAAGCAGCCTACGGTAGACAG -3'
(R):5'- TGTATGCAGCCGTCTTCCTG -3'

Sequencing Primer
(F):5'- CCTACGGTAGACAGCAGAAGGC -3'
(R):5'- TGGGTGTGCCAGGCAAC -3'
Posted On2015-12-29