Incidental Mutation 'R4775:Eml5'
ID367867
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Nameechinoderm microtubule associated protein like 5
SynonymsC130068M19Rik
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location98786805-98901484 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98802307 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1503 (V1503A)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: V1456A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: V1456A

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221511
Predicted Effect unknown
Transcript: ENSMUST00000222097
AA Change: V10A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222593
Predicted Effect probably benign
Transcript: ENSMUST00000223282
AA Change: V1503A

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Gpaa1 T A 15: 76,334,691 probably null Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTGAGTTTATGGCTACAGGGC -3'
(R):5'- ACGTGGAGATGGTTGTAACTC -3'

Sequencing Primer
(F):5'- CAGGGCTTTTTAAAGGGGTCACATAC -3'
(R):5'- ACTCTTAGATTTTATCTTTGTGCAGC -3'
Posted On2015-12-29