Incidental Mutation 'R4775:Gpaa1'
ID367875
Institutional Source Beutler Lab
Gene Symbol Gpaa1
Ensembl Gene ENSMUSG00000022561
Gene NameGPI anchor attachment protein 1
SynonymsmGAA1
MMRRC Submission 041991-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R4775 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76331231-76334907 bp(+) (GRCm38)
Type of Mutationunclassified (2205 bp from exon)
DNA Base Change (assembly) T to A at 76334691 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023221] [ENSMUST00000059045] [ENSMUST00000164972] [ENSMUST00000169378] [ENSMUST00000170121] [ENSMUST00000172281] [ENSMUST00000230512]
Predicted Effect probably damaging
Transcript: ENSMUST00000023221
AA Change: W578R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023221
Gene: ENSMUSG00000022561
AA Change: W578R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Pfam:Gaa1 125 615 3.8e-155 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000059045
SMART Domains Protein: ENSMUSP00000050940
Gene: ENSMUSG00000034259

DomainStartEndE-ValueType
Pfam:RNase_PH 21 152 5.1e-37 PFAM
Pfam:RNase_PH_C 155 220 1.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000074205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164680
Predicted Effect probably benign
Transcript: ENSMUST00000164972
SMART Domains Protein: ENSMUSP00000127108
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168948
SMART Domains Protein: ENSMUSP00000126326
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
Pfam:Gaa1 1 129 1.9e-46 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169378
SMART Domains Protein: ENSMUSP00000128507
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170121
SMART Domains Protein: ENSMUSP00000133173
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171005
Predicted Effect probably damaging
Transcript: ENSMUST00000172281
AA Change: W518R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132986
Gene: ENSMUSG00000022561
AA Change: W518R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Gaa1 64 560 3e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230818
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational glycosylphosphatidylinositol (GPI) anchor attachment serves as a general mechanism for linking proteins to the cell surface membrane. The protein encoded by this gene presumably functions in GPI anchoring at the GPI transfer step. The mRNA transcript is ubiquitously expressed in both fetal and adult tissues. The anchor attachment protein 1 contains an N-terminal signal sequence, 1 cAMP- and cGMP-dependent protein kinase phosphorylation site, 1 leucine zipper pattern, 2 potential N-glycosylation sites, and 8 putative transmembrane domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,243,339 Y426C probably damaging Het
Adam7 A G 14: 68,507,912 I621T probably benign Het
Adamts1 A T 16: 85,800,390 Y260* probably null Het
Adgrf1 C T 17: 43,311,163 L764F probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Atp9b A G 18: 80,765,769 probably null Het
BC067074 A T 13: 113,317,695 I92F possibly damaging Het
C5ar2 A C 7: 16,237,615 L129R probably damaging Het
Ccdc174 G A 6: 91,890,894 probably null Het
Cidec T C 6: 113,434,734 M1V probably null Het
Clec16a G T 16: 10,638,914 R663L probably damaging Het
Col25a1 T C 3: 130,182,819 C118R possibly damaging Het
Cox6b2 A G 7: 4,752,075 C67R probably damaging Het
Cwf19l2 A G 9: 3,430,973 Y435C probably benign Het
Dapk1 T A 13: 60,749,342 S792T probably benign Het
Dis3l T A 9: 64,330,908 N101Y probably benign Het
Dsg4 A G 18: 20,471,127 T884A possibly damaging Het
Dvl1 T C 4: 155,858,127 W617R probably benign Het
Eml5 A G 12: 98,802,307 V1503A probably benign Het
Engase A T 11: 118,482,671 D280V probably benign Het
F11r T C 1: 171,461,641 S224P probably damaging Het
Fanca A G 8: 123,296,306 V564A probably damaging Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gle1 T C 2: 29,936,061 W51R possibly damaging Het
Gm94 A G 18: 43,792,771 probably null Het
Gm9830 A T 9: 44,464,424 noncoding transcript Het
Grin1 C T 2: 25,292,463 A929T possibly damaging Het
Grm7 T A 6: 110,914,371 D188E probably damaging Het
Gtf2ird2 T C 5: 134,214,128 F395L probably benign Het
Lipo1 C A 19: 33,780,395 G225C probably damaging Het
Lonrf2 T A 1: 38,818,059 probably null Het
Marveld2 A G 13: 100,616,795 probably benign Het
Mpl A G 4: 118,448,580 L416P probably damaging Het
Mppe1 A G 18: 67,226,859 L312P possibly damaging Het
Mpzl3 T A 9: 45,066,432 S113T probably damaging Het
Mylk3 G A 8: 85,359,060 Q149* probably null Het
Myt1 T A 2: 181,822,677 I968N probably damaging Het
Ndc80 A G 17: 71,514,270 Y228H probably damaging Het
Nelfcd T G 2: 174,426,576 C520G probably damaging Het
Nfrkb C A 9: 31,419,049 T1199K possibly damaging Het
Nipa2 A G 7: 55,935,863 I109T probably benign Het
Nlrp4e A G 7: 23,343,100 T804A probably benign Het
Nsf A T 11: 103,872,593 I395K possibly damaging Het
Nt5c1b G A 12: 10,375,449 V331I probably damaging Het
Olfr389 A G 11: 73,776,551 Y259H probably damaging Het
Olfr61 A T 7: 140,637,916 I72F probably damaging Het
Pask T C 1: 93,337,524 D3G probably damaging Het
Pglyrp3 T C 3: 92,025,730 V110A possibly damaging Het
Ppp4r3a C T 12: 101,053,566 V377M probably damaging Het
Prr12 A G 7: 45,051,325 probably benign Het
Ptdss1 G A 13: 66,987,858 probably null Het
Qser1 A G 2: 104,789,901 S189P probably damaging Het
Rph3a T A 5: 120,954,488 Y350F probably benign Het
Skint4 A T 4: 112,136,064 H328L probably damaging Het
Smyd4 G A 11: 75,391,192 C497Y probably damaging Het
Stk11ip T C 1: 75,533,853 W864R possibly damaging Het
Stkld1 T A 2: 26,951,745 V543E probably damaging Het
Taok2 A G 7: 126,870,768 S963P probably damaging Het
Tars2 A G 3: 95,746,647 L354P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpcn2 A G 7: 145,267,342 L325P probably damaging Het
Trappc3l C G 10: 34,098,811 H96Q probably benign Het
Trim66 A T 7: 109,457,589 Y1120* probably null Het
Trio G A 15: 27,881,342 Q548* probably null Het
Wipf2 T A 11: 98,890,732 D32E probably benign Het
Other mutations in Gpaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Gpaa1 APN 15 76332998 missense probably benign
IGL02040:Gpaa1 APN 15 76334295 missense probably benign 0.17
IGL02162:Gpaa1 APN 15 76332153 unclassified probably benign
IGL02430:Gpaa1 APN 15 76332188 missense possibly damaging 0.93
IGL02951:Gpaa1 APN 15 76332819 unclassified probably benign
PIT4466001:Gpaa1 UTSW 15 76334740 missense probably benign 0.03
PIT4472001:Gpaa1 UTSW 15 76334740 missense probably benign 0.03
R0137:Gpaa1 UTSW 15 76334781 missense probably damaging 1.00
R0458:Gpaa1 UTSW 15 76332033 missense probably benign 0.06
R0760:Gpaa1 UTSW 15 76331919 missense probably benign 0.01
R1681:Gpaa1 UTSW 15 76331453 missense probably benign
R1691:Gpaa1 UTSW 15 76332216 missense probably damaging 0.99
R2124:Gpaa1 UTSW 15 76333352 missense probably damaging 1.00
R4165:Gpaa1 UTSW 15 76332467 unclassified probably benign
R4166:Gpaa1 UTSW 15 76332467 unclassified probably benign
R4844:Gpaa1 UTSW 15 76332308 unclassified probably benign
R5007:Gpaa1 UTSW 15 76331668 nonsense probably null
R5331:Gpaa1 UTSW 15 76332311 unclassified probably benign
R5804:Gpaa1 UTSW 15 76332626 missense probably damaging 1.00
R5828:Gpaa1 UTSW 15 76332271 unclassified probably benign
R6221:Gpaa1 UTSW 15 76333832 missense probably benign 0.00
Z1088:Gpaa1 UTSW 15 76332542 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCTGGGTTGCATTGCTCTC -3'
(R):5'- ATTTCCCAGGGAGGAGGTAG -3'

Sequencing Primer
(F):5'- TTACCGGATGGCTAGCCCTC -3'
(R):5'- TAGAACGGAGGCTTGGGG -3'
Posted On2015-12-29