Incidental Mutation 'R4776:Med12l'
ID367898
Institutional Source Beutler Lab
Gene Symbol Med12l
Ensembl Gene ENSMUSG00000056476
Gene Namemediator complex subunit 12-like
Synonyms
MMRRC Submission 042413-MU
Accession Numbers

NCBI RefSeq: NM_177855.3; MGI: 2139916

Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R4776 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59005825-59318682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59233212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 868 (I868T)
Ref Sequence ENSEMBL: ENSMUSP00000127038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000050360] [ENSMUST00000164225] [ENSMUST00000199609] [ENSMUST00000199659]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040325
AA Change: I833T

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476
AA Change: I833T

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050360
SMART Domains Protein: ENSMUSP00000051353
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 48 304 1.3e-40 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164225
AA Change: I868T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476
AA Change: I868T

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199609
SMART Domains Protein: ENSMUSP00000143521
Gene: ENSMUSG00000036353

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 1.5e-31 PFAM
low complexity region 322 335 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199659
AA Change: I868T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476
AA Change: I868T

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (94/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the Mediator complex, which is involved in transcriptional coactivation of nearly all RNA polymerase II-dependent genes. The Mediator complex links gene-specific transcriptional activators with the basal transcription machinery. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,719,535 Y683* probably null Het
2610028H24Rik A T 10: 76,457,512 M156L probably benign Het
4930470P17Rik C T 2: 170,579,724 A79T unknown Het
4930522L14Rik A G 5: 109,736,873 I373T probably benign Het
A830010M20Rik C A 5: 107,510,451 A1117E probably damaging Het
Amotl1 G A 9: 14,593,373 Q217* probably null Het
Ankrd28 A T 14: 31,732,054 C254S probably damaging Het
Ap2a1 A G 7: 44,901,546 probably benign Het
Arfgef3 A T 10: 18,654,247 S245T probably benign Het
Arntl A T 7: 113,285,037 K94I probably damaging Het
Atp1b2 A T 11: 69,601,561 D224E probably damaging Het
Boc G A 16: 44,487,721 R924W probably damaging Het
Car14 C T 3: 95,898,873 G292D probably benign Het
Cenpb T C 2: 131,178,183 probably benign Het
Ces1b A T 8: 93,063,030 D423E possibly damaging Het
Cfap54 T A 10: 92,972,694 N1373I possibly damaging Het
Chrdl2 T C 7: 100,006,541 probably benign Het
Cic T G 7: 25,282,883 S12A possibly damaging Het
Csmd2 A T 4: 128,442,892 Q1421L probably benign Het
D630039A03Rik T C 4: 57,910,452 H120R possibly damaging Het
Dicer1 T A 12: 104,692,446 D1779V probably damaging Het
Dock9 G T 14: 121,610,097 H1016N possibly damaging Het
Dxo T C 17: 34,838,998 L352P probably damaging Het
Eif2b5 T A 16: 20,500,233 F78I probably damaging Het
Eri2 A G 7: 119,784,946 probably benign Het
Fam208b A G 13: 3,570,391 F2170S probably damaging Het
Fbxw7 T G 3: 84,925,689 L13V possibly damaging Het
Fgf7 T A 2: 126,035,783 C23* probably null Het
Fubp1 T A 3: 152,222,068 probably null Het
Gm2663 A T 6: 40,995,953 I240N probably damaging Het
Gnb1l C T 16: 18,548,096 Q140* probably null Het
Gnptab G A 10: 88,436,528 R1010Q probably damaging Het
Gtf2h1 G A 7: 46,822,878 W544* probably null Het
Gucy2c C T 6: 136,722,514 E586K probably damaging Het
Hc T A 2: 35,039,734 E232V probably benign Het
Ifi207 T A 1: 173,730,056 D372V unknown Het
Igkv8-28 A T 6: 70,144,118 V15E probably benign Het
Il1rap A G 16: 26,692,799 S198G possibly damaging Het
Lct A G 1: 128,300,387 I1123T probably damaging Het
Lhcgr T C 17: 88,742,697 E467G probably damaging Het
Macf1 C T 4: 123,476,015 R86K probably benign Het
Maml3 T A 3: 51,856,532 Q337L probably benign Het
March10 T A 11: 105,390,037 D474V probably benign Het
March2 G T 17: 33,709,916 T2K probably damaging Het
Mast1 A G 8: 84,937,193 probably null Het
Msrb1 T C 17: 24,740,173 S100P probably damaging Het
Nlrp4c T C 7: 6,066,126 L342P probably benign Het
Nrxn3 T A 12: 90,331,956 V417E possibly damaging Het
Ntng1 T A 3: 109,934,713 D248V probably damaging Het
Oaz3 T C 3: 94,434,998 Q117R probably benign Het
Olfr1311 A G 2: 112,020,931 Y308H probably benign Het
Olfr444 A G 6: 42,955,521 I8V probably benign Het
Olfr589 A G 7: 103,155,414 L111P probably benign Het
Osbpl3 A C 6: 50,300,973 S767A probably benign Het
Pafah1b1 A T 11: 74,685,871 probably benign Het
Pard6b A G 2: 168,098,788 T232A probably damaging Het
Paxip1 A T 5: 27,765,206 C596S probably damaging Het
Pnpla6 T C 8: 3,523,818 V422A probably benign Het
Psmd6 A T 14: 14,120,932 probably benign Het
Rock2 T A 12: 16,977,740 C1353S probably damaging Het
Rpl31-ps17 C T 12: 54,701,612 noncoding transcript Het
Sel1l T A 12: 91,813,893 H658L probably damaging Het
Sh3yl1 T A 12: 30,940,314 L105Q probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sirt1 T C 10: 63,335,722 K227E probably benign Het
Slc25a34 A T 4: 141,623,588 F37I possibly damaging Het
Slc39a5 T A 10: 128,397,049 I378F probably damaging Het
Smarcad1 A T 6: 65,098,824 D731V probably null Het
Sox6 T G 7: 115,541,670 K483N probably damaging Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Srgap1 G T 10: 121,792,351 D882E probably benign Het
Syne4 T C 7: 30,316,833 probably benign Het
Tec T C 5: 72,768,776 Y289C probably benign Het
Tmem102 A T 11: 69,804,802 Y115N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav17 T A 14: 53,806,640 M1K probably null Het
Trdn T A 10: 33,399,082 probably null Het
Trp53 A T 11: 69,586,921 I8F probably benign Het
Ttn T A 2: 76,754,662 D22064V probably damaging Het
Ube3c G A 5: 29,632,838 probably null Het
Ulk1 C T 5: 110,788,947 probably null Het
Upp1 T C 11: 9,135,976 V271A probably damaging Het
Vmn2r4 T C 3: 64,388,661 E901G probably damaging Het
Vmn2r96 G A 17: 18,597,508 G449D probably damaging Het
Vps37b T C 5: 124,006,612 K165E probably damaging Het
Vwf A T 6: 125,566,305 I185F possibly damaging Het
Wasf2 A G 4: 133,185,004 T56A probably benign Het
Zdhhc23 C G 16: 43,973,589 D241H possibly damaging Het
Zfp276 T C 8: 123,254,884 S57P probably benign Het
Zxdc A G 6: 90,370,518 H287R probably damaging Het
Other mutations in Med12l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Med12l APN 3 59042336 missense probably damaging 0.98
IGL00561:Med12l APN 3 59227824 missense probably benign
IGL00974:Med12l APN 3 59083014 missense probably damaging 1.00
IGL01024:Med12l APN 3 59073341 missense probably damaging 1.00
IGL01094:Med12l APN 3 59093655 missense probably damaging 0.99
IGL01134:Med12l APN 3 59042275 missense possibly damaging 0.91
IGL01535:Med12l APN 3 59262259 missense probably damaging 1.00
IGL01653:Med12l APN 3 59261893 missense probably damaging 1.00
IGL01735:Med12l APN 3 59263254 missense probably damaging 1.00
IGL01972:Med12l APN 3 59261893 missense probably damaging 1.00
IGL02005:Med12l APN 3 59244947 missense probably damaging 1.00
IGL02098:Med12l APN 3 59275855 missense possibly damaging 0.92
IGL02115:Med12l APN 3 59068319 missense probably benign 0.00
IGL02231:Med12l APN 3 59245882 missense probably damaging 1.00
IGL02259:Med12l APN 3 59245843 missense probably damaging 1.00
IGL02369:Med12l APN 3 59257373 missense probably benign 0.00
IGL02424:Med12l APN 3 59092722 missense probably benign 0.21
IGL02501:Med12l APN 3 59261976 missense possibly damaging 0.71
IGL02525:Med12l APN 3 59068368 missense probably benign 0.01
IGL02530:Med12l APN 3 59077089 missense probably damaging 1.00
IGL02735:Med12l APN 3 59093646 missense probably damaging 1.00
IGL02865:Med12l APN 3 59294292 missense probably damaging 1.00
IGL03183:Med12l APN 3 59037555 splice site probably null
IGL03264:Med12l APN 3 59301367 nonsense probably null
FR4304:Med12l UTSW 3 59275982 small insertion probably benign
FR4340:Med12l UTSW 3 59275985 small insertion probably benign
FR4342:Med12l UTSW 3 59275988 small insertion probably benign
FR4342:Med12l UTSW 3 59275994 small insertion probably benign
FR4449:Med12l UTSW 3 59275963 nonsense probably null
FR4548:Med12l UTSW 3 59275982 small insertion probably benign
FR4589:Med12l UTSW 3 59275956 small insertion probably benign
FR4976:Med12l UTSW 3 59275977 small insertion probably benign
P0007:Med12l UTSW 3 59091395 splice site probably benign
P0045:Med12l UTSW 3 59091535 missense probably damaging 0.99
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0030:Med12l UTSW 3 59248655 missense probably damaging 1.00
R0148:Med12l UTSW 3 59037654 missense probably damaging 1.00
R0325:Med12l UTSW 3 59077059 missense possibly damaging 0.88
R0330:Med12l UTSW 3 59227702 missense probably damaging 1.00
R0388:Med12l UTSW 3 59093504 splice site probably benign
R0542:Med12l UTSW 3 59042401 missense probably damaging 1.00
R0624:Med12l UTSW 3 59037702 nonsense probably null
R0625:Med12l UTSW 3 59247437 missense probably damaging 1.00
R0671:Med12l UTSW 3 59264929 missense probably damaging 1.00
R0706:Med12l UTSW 3 59261980 missense probably damaging 1.00
R0785:Med12l UTSW 3 59260832 missense probably damaging 1.00
R1054:Med12l UTSW 3 59248651 missense probably damaging 0.99
R1102:Med12l UTSW 3 59244836 missense probably damaging 0.99
R1391:Med12l UTSW 3 59037738 missense probably benign 0.00
R1501:Med12l UTSW 3 59260835 critical splice donor site probably null
R1544:Med12l UTSW 3 59265240 missense possibly damaging 0.71
R1662:Med12l UTSW 3 59093617 missense probably damaging 1.00
R1670:Med12l UTSW 3 59275958 small insertion probably benign
R1839:Med12l UTSW 3 59068319 missense probably benign
R1854:Med12l UTSW 3 59260772 missense probably damaging 1.00
R2045:Med12l UTSW 3 59262310 nonsense probably null
R2070:Med12l UTSW 3 59244905 missense probably damaging 1.00
R2132:Med12l UTSW 3 59265282 unclassified probably null
R2290:Med12l UTSW 3 59244938 missense probably damaging 1.00
R2325:Med12l UTSW 3 59232454 missense probably damaging 0.99
R2352:Med12l UTSW 3 59240692 missense probably damaging 1.00
R2484:Med12l UTSW 3 59297838 missense probably benign 0.18
R2906:Med12l UTSW 3 59257082 missense probably damaging 1.00
R3735:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3736:Med12l UTSW 3 59091495 missense probably damaging 1.00
R3774:Med12l UTSW 3 59247942 missense probably damaging 0.97
R3957:Med12l UTSW 3 59073168 missense probably damaging 0.99
R4020:Med12l UTSW 3 59247942 missense probably damaging 0.97
R4087:Med12l UTSW 3 59297921 missense probably benign 0.00
R4231:Med12l UTSW 3 59257223 splice site probably null
R4233:Med12l UTSW 3 59257223 splice site probably null
R4235:Med12l UTSW 3 59257223 splice site probably null
R4236:Med12l UTSW 3 59257223 splice site probably null
R4327:Med12l UTSW 3 59265267 missense probably benign 0.01
R4328:Med12l UTSW 3 59265267 missense probably benign 0.01
R4346:Med12l UTSW 3 59031555 missense probably damaging 1.00
R4543:Med12l UTSW 3 59091508 missense probably damaging 1.00
R4559:Med12l UTSW 3 59007102 critical splice donor site probably null
R4877:Med12l UTSW 3 59244793 missense probably damaging 1.00
R4983:Med12l UTSW 3 59261929 missense probably damaging 1.00
R5114:Med12l UTSW 3 59259688 missense possibly damaging 0.85
R5125:Med12l UTSW 3 59267214 missense possibly damaging 0.83
R5230:Med12l UTSW 3 59245788 missense probably damaging 1.00
R5407:Med12l UTSW 3 59258201 missense probably damaging 1.00
R5426:Med12l UTSW 3 59248722 missense probably damaging 0.98
R5439:Med12l UTSW 3 59263213 missense probably null 1.00
R5449:Med12l UTSW 3 59259706 missense probably damaging 1.00
R5596:Med12l UTSW 3 59252350 missense probably benign 0.45
R5716:Med12l UTSW 3 59301377 critical splice donor site probably null
R5833:Med12l UTSW 3 59265226 missense possibly damaging 0.95
R5883:Med12l UTSW 3 59091468 missense probably damaging 1.00
R6264:Med12l UTSW 3 59256002 missense probably damaging 1.00
R6269:Med12l UTSW 3 59227822 missense probably damaging 1.00
R6394:Med12l UTSW 3 59235087 missense probably damaging 1.00
R6400:Med12l UTSW 3 59247911 missense probably damaging 1.00
R6475:Med12l UTSW 3 59257079 missense probably damaging 1.00
R6489:Med12l UTSW 3 59257407 missense probably damaging 0.99
R6654:Med12l UTSW 3 59262292 missense probably damaging 1.00
R6881:Med12l UTSW 3 59267165 missense probably benign 0.00
R7110:Med12l UTSW 3 59262224 missense possibly damaging 0.92
R7134:Med12l UTSW 3 59093759 nonsense probably null
R7137:Med12l UTSW 3 59258254 missense probably damaging 1.00
X0062:Med12l UTSW 3 59233179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATGAATTCATATGTGTTGCTGG -3'
(R):5'- TCAGACAAGCTCAACAGTAAGG -3'

Sequencing Primer
(F):5'- CCTTGCTTTTGTCTGAGCA -3'
(R):5'- CTCAACAGTAAGGGATAGCCTG -3'
Posted On2015-12-29