Incidental Mutation 'R4777:Smim1'
ID368009
Institutional Source Beutler Lab
Gene Symbol Smim1
Ensembl Gene ENSMUSG00000078350
Gene Namesmall integral membrane protein 1
Synonyms2700009I11Rik, 1190007F08Rik, 0610011H04Rik
MMRRC Submission 041992-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4777 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154020470-154026230 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 154023650 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030894] [ENSMUST00000047207] [ENSMUST00000125533] [ENSMUST00000126119] [ENSMUST00000130175] [ENSMUST00000131325] [ENSMUST00000132541] [ENSMUST00000139569] [ENSMUST00000143047] [ENSMUST00000145527] [ENSMUST00000146054] [ENSMUST00000146426] [ENSMUST00000146543] [ENSMUST00000169622] [ENSMUST00000182151] [ENSMUST00000182191]
Predicted Effect probably benign
Transcript: ENSMUST00000030894
SMART Domains Protein: ENSMUSP00000030894
Gene: ENSMUSG00000029028

DomainStartEndE-ValueType
low complexity region 1 7 N/A INTRINSIC
low complexity region 10 36 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
LRR_TYP 100 123 2.61e-4 SMART
LRR_TYP 130 153 2.12e-4 SMART
LRR 155 177 3.75e0 SMART
LRR 180 202 9.77e1 SMART
LRR_TYP 203 226 2.27e-4 SMART
low complexity region 261 272 N/A INTRINSIC
low complexity region 277 292 N/A INTRINSIC
B3_4 331 507 8.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047207
SMART Domains Protein: ENSMUSP00000039642
Gene: ENSMUSG00000039492

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
coiled coil region 203 243 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 329 358 N/A INTRINSIC
coiled coil region 390 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125533
SMART Domains Protein: ENSMUSP00000138324
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126119
SMART Domains Protein: ENSMUSP00000138560
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126624
Predicted Effect probably benign
Transcript: ENSMUST00000130175
SMART Domains Protein: ENSMUSP00000138675
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000131325
AA Change: T50A
SMART Domains Protein: ENSMUSP00000138777
Gene: ENSMUSG00000078350
AA Change: T50A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132541
SMART Domains Protein: ENSMUSP00000138471
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142794
Predicted Effect probably benign
Transcript: ENSMUST00000143047
SMART Domains Protein: ENSMUSP00000138733
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145527
SMART Domains Protein: ENSMUSP00000138448
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146054
SMART Domains Protein: ENSMUSP00000138605
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146426
Predicted Effect unknown
Transcript: ENSMUST00000146543
AA Change: T50A
SMART Domains Protein: ENSMUSP00000138267
Gene: ENSMUSG00000078350
AA Change: T50A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163672
Predicted Effect probably benign
Transcript: ENSMUST00000167947
SMART Domains Protein: ENSMUSP00000131382
Gene: ENSMUSG00000029028

DomainStartEndE-ValueType
Pfam:B3_4 1 54 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169622
SMART Domains Protein: ENSMUSP00000133124
Gene: ENSMUSG00000029028

DomainStartEndE-ValueType
low complexity region 22 29 N/A INTRINSIC
low complexity region 32 58 N/A INTRINSIC
low complexity region 65 76 N/A INTRINSIC
LRR_TYP 122 145 2.61e-4 SMART
LRR_TYP 152 175 2.12e-4 SMART
LRR 177 199 3.75e0 SMART
LRR 202 224 9.77e1 SMART
LRR_TYP 225 248 2.27e-4 SMART
low complexity region 283 294 N/A INTRINSIC
low complexity region 299 314 N/A INTRINSIC
B3_4 353 529 8.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182151
SMART Domains Protein: ENSMUSP00000138692
Gene: ENSMUSG00000078350

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182191
AA Change: T50A
SMART Domains Protein: ENSMUSP00000138710
Gene: ENSMUSG00000078350
AA Change: T50A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a small, conserved protein that participates in red blood cell formation. The encoded protein is localized to the cell membrane and is the antigen for the Vel blood group. Alternative splicing results in different transcript variants that encode the same protein. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdca2 C T 14: 67,713,140 R114Q probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ica1 A T 6: 8,644,145 D381E probably benign Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mcf2l T A 8: 13,018,051 probably null Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr398 A G 11: 73,984,395 V71A probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plk2 A C 13: 110,397,773 M296L probably benign Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Ppfia3 C A 7: 45,341,157 G1066V probably damaging Het
Prokr1 A G 6: 87,588,860 M1T probably null Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Smim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2921:Smim1 UTSW 4 154023640 intron probably benign
R6452:Smim1 UTSW 4 154023614 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACAGCTTCTGGGAGATCCTAG -3'
(R):5'- TCTCCTCCCTGAATGTGGTAG -3'

Sequencing Primer
(F):5'- TCCTAGAATAAGAACAGCCAGTG -3'
(R):5'- TGGTAGCTCCACCCCAG -3'
Posted On2015-12-29