Incidental Mutation 'R4777:Ica1'
ID368010
Institutional Source Beutler Lab
Gene Symbol Ica1
Ensembl Gene ENSMUSG00000062995
Gene Nameislet cell autoantigen 1
SynonymsICA69, 69kDa
MMRRC Submission 041992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R4777 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location8630527-8778488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8644145 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 381 (D381E)
Ref Sequence ENSEMBL: ENSMUSP00000111182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038403] [ENSMUST00000115519] [ENSMUST00000115520] [ENSMUST00000156695]
Predicted Effect probably benign
Transcript: ENSMUST00000038403
AA Change: D381E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040062
Gene: ENSMUSG00000062995
AA Change: D381E

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115519
AA Change: D368E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111181
Gene: ENSMUSG00000062995
AA Change: D368E

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 465 4.01e-83 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115520
AA Change: D381E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111182
Gene: ENSMUSG00000062995
AA Change: D381E

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
ICA69 260 478 1.25e-93 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145870
Predicted Effect probably benign
Transcript: ENSMUST00000156695
SMART Domains Protein: ENSMUSP00000138459
Gene: ENSMUSG00000062995

DomainStartEndE-ValueType
Arfaptin 21 248 1.54e-125 SMART
Pfam:ICA69 260 301 4.1e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with an arfaptin homology domain that is found both in the cytosol and as membrane-bound form on the Golgi complex and immature secretory granules. This protein is believed to be an autoantigen in insulin-dependent diabetes mellitus and primary Sjogren's syndrome. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in diabetes and spontaneous lethality at 4-5 months of age on a NOD background, however mice on a 129/Sv background are normal. Onset of diabetes starts 4 weeks later than wild-type NOD mice and mutants are resistant to cyclophospamide-accelerated diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdca2 C T 14: 67,713,140 R114Q probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mcf2l T A 8: 13,018,051 probably null Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr398 A G 11: 73,984,395 V71A probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plk2 A C 13: 110,397,773 M296L probably benign Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Ppfia3 C A 7: 45,341,157 G1066V probably damaging Het
Prokr1 A G 6: 87,588,860 M1T probably null Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Smim1 T C 4: 154,023,650 probably benign Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Ica1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ica1 APN 6 8653514 missense probably benign
IGL02248:Ica1 APN 6 8758387 utr 5 prime probably benign
IGL02547:Ica1 APN 6 8670691 splice site probably null
round_heels UTSW 6 8630799 critical splice acceptor site
R0099:Ica1 UTSW 6 8749778 splice site probably benign
R0244:Ica1 UTSW 6 8653632 nonsense probably null
R0479:Ica1 UTSW 6 8754627 missense probably damaging 1.00
R0479:Ica1 UTSW 6 8754683 missense probably damaging 1.00
R0628:Ica1 UTSW 6 8644256 splice site probably benign
R0826:Ica1 UTSW 6 8667375 intron probably benign
R1186:Ica1 UTSW 6 8672326 missense probably damaging 1.00
R1384:Ica1 UTSW 6 8742262 nonsense probably null
R1957:Ica1 UTSW 6 8749736 missense possibly damaging 0.85
R2431:Ica1 UTSW 6 8658265 missense probably benign
R3722:Ica1 UTSW 6 8659021 intron probably benign
R4224:Ica1 UTSW 6 8659960 missense probably benign 0.11
R5633:Ica1 UTSW 6 8667257 missense possibly damaging 0.73
R5786:Ica1 UTSW 6 8672391 missense possibly damaging 0.50
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6033:Ica1 UTSW 6 8630799 critical splice acceptor site probably null
R6053:Ica1 UTSW 6 8630783 missense probably benign 0.01
R6221:Ica1 UTSW 6 8644181 missense possibly damaging 0.82
R6794:Ica1 UTSW 6 8653659 missense probably benign 0.00
R6819:Ica1 UTSW 6 8742288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGAGGCCTGGAGATCTTTC -3'
(R):5'- CTGTTAATAAAGGGTGTCATGGGAC -3'

Sequencing Primer
(F):5'- CATATTTTGGTCTAAAAGCTGTGACG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2015-12-29