Incidental Mutation 'R4777:Prokr1'
ID368013
Institutional Source Beutler Lab
Gene Symbol Prokr1
Ensembl Gene ENSMUSG00000049409
Gene Nameprokineticin receptor 1
SynonymsPkr1, Gpr73, EG-VEGFR1
MMRRC Submission 041992-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4777 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location87578591-87590743 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 87588860 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000144999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050887] [ENSMUST00000203636] [ENSMUST00000204682]
Predicted Effect probably null
Transcript: ENSMUST00000050887
AA Change: M1T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059034
Gene: ENSMUSG00000049409
AA Change: M1T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 73 360 8.8e-8 PFAM
Pfam:7tm_1 79 342 7.2e-47 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203636
AA Change: M1T

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145476
Gene: ENSMUSG00000049409
AA Change: M1T

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000204682
AA Change: M1T

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144999
Gene: ENSMUSG00000049409
AA Change: M1T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 73 360 8.8e-8 PFAM
Pfam:7tm_1 79 342 7.2e-47 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein-coupled receptor family. The encoded protein binds to prokineticins (1 and 2), leading to the activation of MAPK and STAT signaling pathways. Prokineticins are protein ligands involved in angiogenesis and inflammation. The encoded protein is expressed in peripheral tissues such as those comprising the circulatory system, lungs, reproductive system, endocrine system and the gastrointestinal system. The protein may be involved in signaling in human fetal ovary during initiation of primordial follicle formation. Sequence variants in this gene may be associated with recurrent miscarriage. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit abnormal nociceptions and hypoalgesia. Mice homozygous for another null allele exhibit decreased capillary density in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdca2 C T 14: 67,713,140 R114Q probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ica1 A T 6: 8,644,145 D381E probably benign Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mcf2l T A 8: 13,018,051 probably null Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr398 A G 11: 73,984,395 V71A probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plk2 A C 13: 110,397,773 M296L probably benign Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Ppfia3 C A 7: 45,341,157 G1066V probably damaging Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Smim1 T C 4: 154,023,650 probably benign Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Prokr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Prokr1 APN 6 87588611 missense probably damaging 1.00
IGL00838:Prokr1 APN 6 87588693 missense possibly damaging 0.94
IGL01083:Prokr1 APN 6 87588784 missense probably benign 0.41
IGL02677:Prokr1 APN 6 87588368 splice site probably benign
IGL03344:Prokr1 APN 6 87588500 missense possibly damaging 0.95
R1953:Prokr1 UTSW 6 87588593 missense probably benign 0.18
R2065:Prokr1 UTSW 6 87588713 missense probably damaging 0.98
R3161:Prokr1 UTSW 6 87588431 missense probably damaging 1.00
R4828:Prokr1 UTSW 6 87581242 missense probably benign 0.07
R4890:Prokr1 UTSW 6 87588696 missense probably benign 0.00
R4943:Prokr1 UTSW 6 87581824 missense possibly damaging 0.90
R6134:Prokr1 UTSW 6 87588855 missense possibly damaging 0.54
R6183:Prokr1 UTSW 6 87588852 missense possibly damaging 0.94
R6329:Prokr1 UTSW 6 87581792 missense possibly damaging 0.94
R6794:Prokr1 UTSW 6 87588693 missense possibly damaging 0.94
R6922:Prokr1 UTSW 6 87588473 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATGCCACACACTAGCATG -3'
(R):5'- CCCTCCAACATGTAACCAATTGTG -3'

Sequencing Primer
(F):5'- GCCATGCCAATGACAATCTTGG -3'
(R):5'- ACCAATTGTGTGTATGTCTTTCGAAG -3'
Posted On2015-12-29