Incidental Mutation 'R4777:Mcf2l'
ID368023
Institutional Source Beutler Lab
Gene Symbol Mcf2l
Ensembl Gene ENSMUSG00000031442
Gene Namemcf.2 transforming sequence-like
SynonymsC130040G20Rik, Dbs
MMRRC Submission 041992-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R4777 (G1)
Quality Score186
Status Not validated
Chromosome8
Chromosomal Location12873806-13020905 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 13018051 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133776 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095456] [ENSMUST00000098927] [ENSMUST00000110866] [ENSMUST00000110867] [ENSMUST00000110871] [ENSMUST00000110873] [ENSMUST00000110876] [ENSMUST00000110879] [ENSMUST00000145067] [ENSMUST00000173099]
Predicted Effect probably null
Transcript: ENSMUST00000095456
SMART Domains Protein: ENSMUSP00000093108
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 75 221 1.77e-24 SMART
SPEC 354 455 4.41e-15 SMART
coiled coil region 507 529 N/A INTRINSIC
low complexity region 578 594 N/A INTRINSIC
RhoGEF 636 811 2.83e-63 SMART
PH 831 948 8.13e-14 SMART
low complexity region 966 978 N/A INTRINSIC
SH3 1058 1115 3.33e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000098927
SMART Domains Protein: ENSMUSP00000096528
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 49 195 1.77e-24 SMART
SPEC 328 429 4.41e-15 SMART
coiled coil region 481 503 N/A INTRINSIC
low complexity region 552 568 N/A INTRINSIC
RhoGEF 610 785 2.83e-63 SMART
PH 805 922 8.13e-14 SMART
low complexity region 940 952 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110866
SMART Domains Protein: ENSMUSP00000106490
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110867
SMART Domains Protein: ENSMUSP00000106491
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 23 169 1.77e-24 SMART
SPEC 302 403 4.41e-15 SMART
coiled coil region 455 477 N/A INTRINSIC
low complexity region 526 542 N/A INTRINSIC
RhoGEF 584 759 2.83e-63 SMART
PH 779 896 8.13e-14 SMART
low complexity region 914 926 N/A INTRINSIC
SH3 1006 1063 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110871
SMART Domains Protein: ENSMUSP00000106495
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SEC14 43 189 1.77e-24 SMART
SPEC 322 423 4.41e-15 SMART
coiled coil region 475 497 N/A INTRINSIC
low complexity region 546 562 N/A INTRINSIC
RhoGEF 604 779 2.83e-63 SMART
PH 799 916 8.13e-14 SMART
low complexity region 934 946 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110873
SMART Domains Protein: ENSMUSP00000106497
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SPEC 165 266 4.41e-15 SMART
coiled coil region 318 340 N/A INTRINSIC
low complexity region 389 405 N/A INTRINSIC
RhoGEF 447 622 2.83e-63 SMART
PH 642 759 8.13e-14 SMART
low complexity region 777 789 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110876
SMART Domains Protein: ENSMUSP00000106500
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1084 1141 3.33e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110879
SMART Domains Protein: ENSMUSP00000106503
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 45 191 1.77e-24 SMART
SPEC 324 425 4.41e-15 SMART
coiled coil region 477 499 N/A INTRINSIC
low complexity region 548 564 N/A INTRINSIC
RhoGEF 606 781 2.83e-63 SMART
PH 801 918 8.13e-14 SMART
low complexity region 936 948 N/A INTRINSIC
SH3 1028 1085 3.33e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118696
Predicted Effect probably null
Transcript: ENSMUST00000123811
SMART Domains Protein: ENSMUSP00000123434
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
PH 1 88 6.67e-1 SMART
low complexity region 106 118 N/A INTRINSIC
SH3 198 255 3.33e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000126905
SMART Domains Protein: ENSMUSP00000118540
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SPEC 5 88 8.25e-6 SMART
coiled coil region 139 161 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
RhoGEF 269 444 2.83e-63 SMART
PH 464 581 8.13e-14 SMART
low complexity region 599 611 N/A INTRINSIC
SH3 716 773 3.33e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127229
Predicted Effect probably null
Transcript: ENSMUST00000134227
SMART Domains Protein: ENSMUSP00000116731
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
Pfam:PH 1 81 1.5e-7 PFAM
low complexity region 101 113 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134989
Predicted Effect probably null
Transcript: ENSMUST00000139776
SMART Domains Protein: ENSMUSP00000120946
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SH3 99 156 3.33e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000145067
SMART Domains Protein: ENSMUSP00000133577
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
Pfam:CRAL_TRIO_2 16 132 2.4e-12 PFAM
SPEC 261 362 4.41e-15 SMART
coiled coil region 414 436 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
RhoGEF 543 718 2.83e-63 SMART
PH 738 855 8.13e-14 SMART
low complexity region 873 885 N/A INTRINSIC
SH3 1021 1078 3.33e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145892
SMART Domains Protein: ENSMUSP00000114758
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
Blast:PH 2 23 1e-6 BLAST
PDB:1KZG|C 2 40 1e-19 PDB
SCOP:d1kz7a2 2 40 6e-7 SMART
low complexity region 41 53 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173099
SMART Domains Protein: ENSMUSP00000133776
Gene: ENSMUSG00000031442

DomainStartEndE-ValueType
SEC14 41 187 1.77e-24 SMART
SPEC 320 421 4.41e-15 SMART
coiled coil region 473 495 N/A INTRINSIC
low complexity region 544 560 N/A INTRINSIC
RhoGEF 602 777 2.83e-63 SMART
PH 797 914 8.13e-14 SMART
low complexity region 932 944 N/A INTRINSIC
low complexity region 1014 1025 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor that interacts specifically with the GTP-bound Rac1 and plays a role in the Rho/Rac signaling pathways. A variant in this gene was associated with osteoarthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdca2 C T 14: 67,713,140 R114Q probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ica1 A T 6: 8,644,145 D381E probably benign Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr398 A G 11: 73,984,395 V71A probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plk2 A C 13: 110,397,773 M296L probably benign Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Ppfia3 C A 7: 45,341,157 G1066V probably damaging Het
Prokr1 A G 6: 87,588,860 M1T probably null Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Smim1 T C 4: 154,023,650 probably benign Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Mcf2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Mcf2l APN 8 13000857 missense probably damaging 0.98
IGL00426:Mcf2l APN 8 12984910 missense probably damaging 1.00
IGL01391:Mcf2l APN 8 13014010 splice site probably null
IGL01795:Mcf2l APN 8 13000749 unclassified probably null
IGL02314:Mcf2l APN 8 13001851 missense probably damaging 0.99
IGL02716:Mcf2l APN 8 12997277 missense probably benign 0.19
IGL02985:Mcf2l APN 8 12963239 missense probably damaging 1.00
IGL03073:Mcf2l APN 8 13000004 missense probably damaging 1.00
IGL03308:Mcf2l APN 8 13009512 missense probably damaging 1.00
IGL03371:Mcf2l APN 8 13001298 missense probably damaging 1.00
P0022:Mcf2l UTSW 8 13018897 nonsense probably null
R0062:Mcf2l UTSW 8 13006766 unclassified probably benign
R0067:Mcf2l UTSW 8 13013060 missense probably benign 0.01
R0110:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0450:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0469:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0510:Mcf2l UTSW 8 12997337 missense probably damaging 1.00
R0543:Mcf2l UTSW 8 12996728 critical splice donor site probably null
R0591:Mcf2l UTSW 8 13018751 missense probably benign 0.11
R0801:Mcf2l UTSW 8 13014020 intron probably benign
R0962:Mcf2l UTSW 8 13001964 missense probably benign 0.14
R1084:Mcf2l UTSW 8 13002645 missense possibly damaging 0.94
R1794:Mcf2l UTSW 8 12915982 missense probably benign 0.33
R2111:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R2112:Mcf2l UTSW 8 13001867 missense probably damaging 0.99
R3785:Mcf2l UTSW 8 12880099 missense probably damaging 0.97
R4858:Mcf2l UTSW 8 13013972 missense probably damaging 1.00
R4980:Mcf2l UTSW 8 12984883 missense probably damaging 1.00
R5021:Mcf2l UTSW 8 13011808 missense probably damaging 1.00
R5067:Mcf2l UTSW 8 12915959 intron probably benign
R5158:Mcf2l UTSW 8 13009715 missense probably damaging 1.00
R5439:Mcf2l UTSW 8 12926646 missense possibly damaging 0.85
R5569:Mcf2l UTSW 8 13005481 missense probably damaging 1.00
R5655:Mcf2l UTSW 8 13010444 missense probably damaging 0.98
R5668:Mcf2l UTSW 8 13013812 nonsense probably null
R5753:Mcf2l UTSW 8 12999993 missense probably damaging 1.00
R5808:Mcf2l UTSW 8 12993937 start codon destroyed probably null 0.92
R5946:Mcf2l UTSW 8 13013922 missense probably damaging 1.00
R6168:Mcf2l UTSW 8 13001823 missense probably benign 0.05
R6174:Mcf2l UTSW 8 13013849 nonsense probably null
R6212:Mcf2l UTSW 8 13017431 missense probably damaging 1.00
R6270:Mcf2l UTSW 8 13018701 missense probably damaging 0.99
R6383:Mcf2l UTSW 8 12879912 start gained probably benign
R6850:Mcf2l UTSW 8 13009476 missense possibly damaging 0.82
R6908:Mcf2l UTSW 8 13018919 missense probably benign
X0052:Mcf2l UTSW 8 13018713 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TTTACAAGTGGCAGAACCCC -3'
(R):5'- GGTAGGAACACACATGGTCATG -3'

Sequencing Primer
(F):5'- CAACACTACACTGGTCTTCCC -3'
(R):5'- TCATGTCTGGGTAGGAACACAC -3'
Posted On2015-12-29