Incidental Mutation 'R4777:Olfr398'
ID368042
Institutional Source Beutler Lab
Gene Symbol Olfr398
Ensembl Gene ENSMUSG00000049041
Gene Nameolfactory receptor 398
SynonymsGA_x6K02T2P1NL-4141430-4140486, MOR157-1
MMRRC Submission 041992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R4777 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73979967-73990407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73984395 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 71 (V71A)
Ref Sequence ENSEMBL: ENSMUSP00000149170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053874] [ENSMUST00000117510] [ENSMUST00000214334]
Predicted Effect probably benign
Transcript: ENSMUST00000053874
AA Change: V71A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000059548
Gene: ENSMUSG00000049041
AA Change: V71A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 4e-50 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 1.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117510
AA Change: V71A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113005
Gene: ENSMUSG00000049041
AA Change: V71A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 3.5e-5 PFAM
Pfam:7tm_1 41 290 6.4e-28 PFAM
Pfam:7tm_4 140 283 4.7e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214334
AA Change: V71A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdca2 C T 14: 67,713,140 R114Q probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ica1 A T 6: 8,644,145 D381E probably benign Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mcf2l T A 8: 13,018,051 probably null Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plk2 A C 13: 110,397,773 M296L probably benign Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Ppfia3 C A 7: 45,341,157 G1066V probably damaging Het
Prokr1 A G 6: 87,588,860 M1T probably null Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Smim1 T C 4: 154,023,650 probably benign Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Olfr398
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr398 APN 11 73984527 missense probably damaging 1.00
IGL01116:Olfr398 APN 11 73984318 missense probably damaging 1.00
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0242:Olfr398 UTSW 11 73983712 missense probably benign
R0647:Olfr398 UTSW 11 73983771 missense probably damaging 0.99
R0906:Olfr398 UTSW 11 73983859 missense probably damaging 0.99
R1581:Olfr398 UTSW 11 73984521 missense probably damaging 1.00
R1792:Olfr398 UTSW 11 73983847 missense probably benign 0.34
R1832:Olfr398 UTSW 11 73984493 missense probably damaging 0.98
R1879:Olfr398 UTSW 11 73984542 missense probably benign 0.00
R2138:Olfr398 UTSW 11 73984303 missense probably damaging 1.00
R2988:Olfr398 UTSW 11 73983801 missense probably benign 0.13
R4557:Olfr398 UTSW 11 73984599 missense probably benign 0.25
R4606:Olfr398 UTSW 11 73983892 missense probably damaging 1.00
R4783:Olfr398 UTSW 11 73984008 missense probably damaging 0.97
R5047:Olfr398 UTSW 11 73984378 missense probably damaging 1.00
R5696:Olfr398 UTSW 11 73984536 missense possibly damaging 0.90
R6379:Olfr398 UTSW 11 73984273 missense probably damaging 1.00
X0012:Olfr398 UTSW 11 73984294 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATAGTGCAGCGGTCTACACAC -3'
(R):5'- TTCAGCATTCCCATGGGTAC -3'

Sequencing Primer
(F):5'- GGTCTACACACAGCCACCG -3'
(R):5'- TCCATGGCTGTGACCAAC -3'
Posted On2015-12-29