Incidental Mutation 'R4777:Cdca2'
ID368052
Institutional Source Beutler Lab
Gene Symbol Cdca2
Ensembl Gene ENSMUSG00000048922
Gene Namecell division cycle associated 2
Synonyms2610311M19Rik
MMRRC Submission 041992-MU
Accession Numbers

Genbank: NM_001110162, NM_175384

Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R4777 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67676331-67715841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67713140 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 114 (R114Q)
Ref Sequence ENSEMBL: ENSMUSP00000116384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078053] [ENSMUST00000124045] [ENSMUST00000125212] [ENSMUST00000132705] [ENSMUST00000145542] [ENSMUST00000150006] [ENSMUST00000150768] [ENSMUST00000152243] [ENSMUST00000156700] [ENSMUST00000163100]
Predicted Effect probably benign
Transcript: ENSMUST00000078053
SMART Domains Protein: ENSMUSP00000077200
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 3.5e-22 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 253 292 1e-14 PFAM
Pfam:Pentapeptide_4 258 334 2.7e-15 PFAM
Pfam:Pentapeptide 288 327 6.8e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124045
AA Change: R114Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000125212
Predicted Effect possibly damaging
Transcript: ENSMUST00000132705
AA Change: R114Q

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115633
Gene: ENSMUSG00000048922
AA Change: R114Q

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 4.3e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145542
Predicted Effect possibly damaging
Transcript: ENSMUST00000150006
AA Change: R114Q

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117847
Gene: ENSMUSG00000048922
AA Change: R114Q

DomainStartEndE-ValueType
Pfam:PP1_bind 378 437 5.4e-28 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150768
SMART Domains Protein: ENSMUSP00000114489
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:KHA 2 64 1.4e-21 PFAM
BTB 89 192 1.76e-16 SMART
Pfam:Pentapeptide 219 255 9.3e-8 PFAM
Pfam:Pentapeptide 248 280 9.3e-11 PFAM
Pfam:Pentapeptide 258 297 3e-10 PFAM
Pfam:Pentapeptide 303 342 3.2e-13 PFAM
Pfam:Pentapeptide_4 308 384 3.3e-13 PFAM
Pfam:Pentapeptide 338 377 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152243
SMART Domains Protein: ENSMUSP00000120440
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:BTB_2 1 70 1.3e-13 PFAM
Pfam:BTB 1 78 6.2e-7 PFAM
Pfam:Pentapeptide 105 137 4.3e-8 PFAM
Pfam:Pentapeptide 134 166 5.5e-11 PFAM
Pfam:Pentapeptide 144 183 1.5e-10 PFAM
Pfam:Pentapeptide_4 165 239 5.3e-9 PFAM
Pfam:Pentapeptide 189 228 1.7e-13 PFAM
Pfam:Pentapeptide 209 237 9.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155312
Predicted Effect probably benign
Transcript: ENSMUST00000156700
SMART Domains Protein: ENSMUSP00000115002
Gene: ENSMUSG00000034327

DomainStartEndE-ValueType
Pfam:DUF3354 1 65 2.5e-23 PFAM
SCOP:d3kvt__ 89 107 9e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163100
AA Change: R114Q

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127571
Gene: ENSMUSG00000048922
AA Change: R114Q

DomainStartEndE-ValueType
Pfam:PP1_bind 379 436 4.1e-27 PFAM
low complexity region 515 528 N/A INTRINSIC
low complexity region 542 556 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a targeting subunit of the cell-cycle associated protein, protein phosphatase 1, with a role in targeting this protein to chromatin during anaphase. These two proteins comprise a phosphatase complex that is involved in nuclear envelope reformation and regulation of the DNA damage response. The encoded protein may also play a role in cancer progression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(24) : Gene trapped(24)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A C 3: 138,065,742 S231R probably benign Het
2010109I03Rik T C 15: 74,880,683 N48S probably benign Het
5730455P16Rik A T 11: 80,374,215 I137N probably damaging Het
Abhd10 G A 16: 45,736,916 Q176* probably null Het
Acer3 T C 7: 98,261,597 Y86C probably damaging Het
Ankrd36 T C 11: 5,607,120 V356A probably benign Het
Atp1a1 A G 3: 101,594,996 probably null Het
Bmp8b G A 4: 123,122,000 R260Q possibly damaging Het
C2cd3 T A 7: 100,416,332 V775D possibly damaging Het
Cacna1b T A 2: 24,732,325 I216F probably damaging Het
Capn5 T A 7: 98,131,718 N284I probably damaging Het
Cbr1 C A 16: 93,610,054 D219E probably benign Het
Ccdc109b T A 3: 129,969,951 Q42L probably damaging Het
Cdh7 G A 1: 109,994,325 W49* probably null Het
Cep152 C T 2: 125,564,095 V1506I probably benign Het
Cfap97 C T 8: 46,195,297 Q537* probably null Het
Cpsf2 T A 12: 101,996,832 V385E probably damaging Het
Dse A G 10: 34,153,588 V502A possibly damaging Het
Fam171a1 T A 2: 3,223,513 F300L probably benign Het
Fnip1 T G 11: 54,500,556 N438K probably damaging Het
Fstl5 C T 3: 76,593,500 T412M probably damaging Het
Gm11938 T A 11: 99,603,233 Q12L unknown Het
Hcls1 G T 16: 36,955,316 A171S probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Hydin G T 8: 110,410,464 C633F probably damaging Het
Ica1 A T 6: 8,644,145 D381E probably benign Het
Ift74 A G 4: 94,652,997 K220E probably benign Het
Igfn1 A T 1: 135,954,862 D2748E probably benign Het
Il16 A C 7: 83,650,896 D396E probably benign Het
Impdh1 G T 6: 29,205,202 A200E possibly damaging Het
Itga4 C T 2: 79,313,710 T647I possibly damaging Het
Jpt1 A T 11: 115,500,671 M104K probably benign Het
Krt73 C A 15: 101,794,001 A476S probably benign Het
Lama3 T C 18: 12,413,771 Y363H probably damaging Het
Lgr4 C T 2: 109,996,682 P177L probably damaging Het
Lrp2 T C 2: 69,482,264 D2560G probably damaging Het
Macf1 A T 4: 123,376,502 F6617I probably damaging Het
Mcf2l T A 8: 13,018,051 probably null Het
Mfsd9 C T 1: 40,781,540 V150I possibly damaging Het
Myo15b T C 11: 115,879,652 V96A probably damaging Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Olfr398 A G 11: 73,984,395 V71A probably benign Het
Olfr432 T G 1: 174,050,678 Y102D probably damaging Het
Olfr981 T C 9: 40,022,698 F102L possibly damaging Het
Pinlyp T A 7: 24,542,143 I153F possibly damaging Het
Plk2 A C 13: 110,397,773 M296L probably benign Het
Plvap T C 8: 71,507,986 Y262C probably benign Het
Ppfia3 C A 7: 45,341,157 G1066V probably damaging Het
Prokr1 A G 6: 87,588,860 M1T probably null Het
Ptgs2 G T 1: 150,105,387 A474S probably benign Het
Pth2r A G 1: 65,388,517 T450A possibly damaging Het
Ranbp6 A T 19: 29,811,637 F438L probably damaging Het
Ripor1 A T 8: 105,614,990 Q102L probably damaging Het
Rprd2 C T 3: 95,787,374 V116I probably benign Het
Sacs T C 14: 61,211,809 V3768A probably damaging Het
Scn8a T C 15: 101,015,951 Y1075H probably damaging Het
Senp3 C T 11: 69,678,237 G366D probably damaging Het
Smim1 T C 4: 154,023,650 probably benign Het
Sptan1 A G 2: 29,996,435 I817V probably damaging Het
Stag3 A T 5: 138,309,199 probably benign Het
Stk17b A T 1: 53,771,708 H79Q probably damaging Het
Svil A G 18: 5,088,813 K1296E probably damaging Het
Tmem117 T A 15: 95,094,450 Y330* probably null Het
Tmem8 T C 17: 26,121,541 V633A probably damaging Het
Tnxb G T 17: 34,671,943 R420L probably damaging Het
Trim9 C A 12: 70,347,071 C33F probably damaging Het
Usp29 A C 7: 6,962,748 Y530S probably benign Het
Vps26b T C 9: 27,010,456 T258A possibly damaging Het
Vrtn C A 12: 84,648,826 H117N probably damaging Het
Wdr33 C T 18: 31,881,248 H388Y probably damaging Het
Zfp451 A T 1: 33,782,105 V222D possibly damaging Het
Zfp953 A G 13: 67,343,129 I253T probably benign Het
Zfy2 A G Y: 2,116,194 V282A probably benign Het
Zscan29 A T 2: 121,169,324 V132D probably damaging Het
Zswim4 G T 8: 84,236,957 D16E probably benign Het
Other mutations in Cdca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Cdca2 APN 14 67714697 missense probably damaging 0.99
IGL01413:Cdca2 APN 14 67677894 missense probably damaging 0.98
IGL01962:Cdca2 APN 14 67705723 missense probably damaging 0.99
IGL01982:Cdca2 APN 14 67677719 missense probably damaging 0.98
IGL02198:Cdca2 APN 14 67694996 missense probably benign 0.00
IGL02208:Cdca2 APN 14 67713140 missense probably damaging 0.99
IGL02883:Cdca2 APN 14 67707497 missense probably damaging 1.00
IGL03069:Cdca2 APN 14 67714936 splice site probably benign
F5493:Cdca2 UTSW 14 67677692 missense probably damaging 0.99
IGL03046:Cdca2 UTSW 14 67700022 intron probably benign
R0254:Cdca2 UTSW 14 67677178 missense probably damaging 0.99
R0350:Cdca2 UTSW 14 67713119 missense probably benign 0.02
R0368:Cdca2 UTSW 14 67700347 missense possibly damaging 0.89
R0398:Cdca2 UTSW 14 67697962 missense probably damaging 0.98
R0790:Cdca2 UTSW 14 67680291 missense probably benign
R1104:Cdca2 UTSW 14 67693682 missense probably damaging 0.99
R1474:Cdca2 UTSW 14 67714906 intron probably benign
R1658:Cdca2 UTSW 14 67677699 missense possibly damaging 0.93
R1782:Cdca2 UTSW 14 67677811 missense probably benign 0.22
R2150:Cdca2 UTSW 14 67714809 missense probably damaging 1.00
R2154:Cdca2 UTSW 14 67676976 missense probably damaging 0.99
R2155:Cdca2 UTSW 14 67714838 missense probably damaging 1.00
R2862:Cdca2 UTSW 14 67698090 missense probably damaging 1.00
R3156:Cdca2 UTSW 14 67698163 missense possibly damaging 0.91
R3840:Cdca2 UTSW 14 67680271 nonsense probably null
R4043:Cdca2 UTSW 14 67704006 missense probably benign 0.11
R4293:Cdca2 UTSW 14 67714850 missense probably benign 0.06
R4679:Cdca2 UTSW 14 67714966 missense possibly damaging 0.68
R4829:Cdca2 UTSW 14 67693753 critical splice acceptor site probably null
R4843:Cdca2 UTSW 14 67676976 missense probably damaging 1.00
R5031:Cdca2 UTSW 14 67713153 missense probably damaging 1.00
R5181:Cdca2 UTSW 14 67680165 missense probably damaging 0.98
R5331:Cdca2 UTSW 14 67677471 missense possibly damaging 0.91
R5490:Cdca2 UTSW 14 67680284 missense possibly damaging 0.91
R5695:Cdca2 UTSW 14 67705629 critical splice donor site probably null
R6246:Cdca2 UTSW 14 67677828 nonsense probably null
R6866:Cdca2 UTSW 14 67693666 missense possibly damaging 0.92
R6928:Cdca2 UTSW 14 67705744 missense probably damaging 0.98
R6955:Cdca2 UTSW 14 67715004 start codon destroyed probably null 0.53
R6986:Cdca2 UTSW 14 67694997 missense probably benign 0.27
Z1088:Cdca2 UTSW 14 67700298 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CCCAGCAAGCAAGTTACCTG -3'
(R):5'- AGTTCTCTGTGACAAGTGCAGAC -3'

Sequencing Primer
(F):5'- AGCAAGTTACCTGCAGTCCCTG -3'
(R):5'- GACAAGTGCAGACTCTGTTTTC -3'
Posted On2015-12-29