Incidental Mutation 'R4778:0610037L13Rik'
List |< first << previous [record 54 of 386652] next >> last >|
ID368076
Institutional Source Beutler Lab
Gene Symbol 0610037L13Rik
Ensembl Gene ENSMUSG00000028608
Gene NameRIKEN cDNA 0610037L13 gene
Synonyms
MMRRC Submission 042414-MU
Accession Numbers
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107889813-107899384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107891998 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 100 (V100A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030346] [ENSMUST00000030347] [ENSMUST00000106726] [ENSMUST00000106727] [ENSMUST00000119394] [ENSMUST00000120473] [ENSMUST00000125107] [ENSMUST00000127715] [ENSMUST00000128474] [ENSMUST00000132417] [ENSMUST00000135454] [ENSMUST00000141376] [ENSMUST00000153593] [ENSMUST00000156888]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030347
Predicted Effect probably damaging
Transcript: ENSMUST00000106726
AA Change: V64A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102337
Gene: ENSMUSG00000028608
AA Change: V64A

DomainStartEndE-ValueType
Pfam:DUF866 1 114 1.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106727
AA Change: V64A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102338
Gene: ENSMUSG00000028608
AA Change: V64A

DomainStartEndE-ValueType
Pfam:DUF866 1 154 1.2e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119394
AA Change: V64A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113991
Gene: ENSMUSG00000028608
AA Change: V64A

DomainStartEndE-ValueType
Pfam:DUF866 1 146 8.1e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120473
AA Change: V64A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113866
Gene: ENSMUSG00000028608
AA Change: V64A

DomainStartEndE-ValueType
Pfam:DUF866 1 138 2.7e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125107
AA Change: V100A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119565
Gene: ENSMUSG00000028608
AA Change: V100A

DomainStartEndE-ValueType
Pfam:DUF866 40 194 2.2e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127715
Predicted Effect probably damaging
Transcript: ENSMUST00000128474
AA Change: V65A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115797
Gene: ENSMUSG00000028608
AA Change: V65A

DomainStartEndE-ValueType
Pfam:DUF866 2 66 4.2e-27 PFAM
Predicted Effect silent
Transcript: ENSMUST00000132417
SMART Domains Protein: ENSMUSP00000117717
Gene: ENSMUSG00000028608

DomainStartEndE-ValueType
Pfam:DUF866 37 98 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135454
AA Change: V64A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114234
Gene: ENSMUSG00000028608
AA Change: V64A

DomainStartEndE-ValueType
Pfam:DUF866 1 160 1.7e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156888
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Clpb T C 7: 101,663,829 V66A silent Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fam134b C A 15: 25,971,785 N394K unknown Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 G305D noncoding transcript Het
Gm13247 T A 4: 146,537,655 S346T probably benign Het
Gm5045 T A 15: 59,211,403 Y166N noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G339R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 T10S unknown Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 T95A noncoding transcript Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D1037V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 C238S noncoding transcript Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Other mutations in 0610037L13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:0610037L13Rik APN 4 107894868 unclassified noncoding transcript
R0787:0610037L13Rik UTSW 4 107890129 missense probably damaging 1.00
R3500:0610037L13Rik UTSW 4 107891513 missense probably damaging 1.00
R4702:0610037L13Rik UTSW 4 107893316 missense noncoding transcript
R5940:0610037L13Rik UTSW 4 107893288 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCTCAACCAGGGGAAGACTC -3'
(R):5'- GACTTGAATCTCTACCCAGACTCC -3'

Sequencing Primer
(F):5'- ACTGAGCATGCTCTACTACTGAG -3'
(R):5'- TCTACCCAGACTCCACTCAGGTG -3'
Posted OnDec 29, 2015