Incidental Mutation 'R4778:Snx1'
ID368092
Institutional Source Beutler Lab
Gene Symbol Snx1
Ensembl Gene ENSMUSG00000032382
Gene Namesorting nexin 1
Synonyms
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location66088133-66126587 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 66101416 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034946] [ENSMUST00000137542]
Predicted Effect probably benign
Transcript: ENSMUST00000034946
SMART Domains Protein: ENSMUSP00000034946
Gene: ENSMUSG00000032382

DomainStartEndE-ValueType
Pfam:Sorting_nexin 10 137 2.6e-29 PFAM
PX 140 267 7.59e-40 SMART
Pfam:Vps5 283 516 3.2e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137542
SMART Domains Protein: ENSMUSP00000120746
Gene: ENSMUSG00000032382

DomainStartEndE-ValueType
Pfam:Sorting_nexin 3 89 6.9e-25 PFAM
PX 92 192 2.37e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146893
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This endosomal protein regulates the cell-surface expression of epidermal growth factor receptor. This protein also has a role in sorting protease-activated receptor-1 from early endosomes to lysosomes. This protein may form oligomeric complexes with family members. This gene results in three transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile and do not exhibit any apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Snx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00806:Snx1 APN 9 66089585 nonsense probably null
IGL01015:Snx1 APN 9 66094431 missense possibly damaging 0.72
IGL02070:Snx1 APN 9 66098449 missense probably damaging 0.97
IGL02225:Snx1 APN 9 66109621 missense probably benign 0.03
IGL02984:Snx1 APN 9 66089108 splice site probably benign
IGL03069:Snx1 APN 9 66094624 missense probably benign
IGL03188:Snx1 APN 9 66094452 missense probably damaging 1.00
FR4589:Snx1 UTSW 9 66104926 small insertion probably benign
FR4976:Snx1 UTSW 9 66104929 small insertion probably benign
FR4976:Snx1 UTSW 9 66104930 small insertion probably benign
R0116:Snx1 UTSW 9 66088539 nonsense probably null
R0243:Snx1 UTSW 9 66101326 splice site probably benign
R0755:Snx1 UTSW 9 66098456 missense probably damaging 1.00
R0981:Snx1 UTSW 9 66109559 missense probably benign
R1495:Snx1 UTSW 9 66096597 missense probably benign 0.23
R1528:Snx1 UTSW 9 66109543 missense probably damaging 1.00
R1725:Snx1 UTSW 9 66098329 critical splice donor site probably null
R3752:Snx1 UTSW 9 66105651 splice site probably null
R4487:Snx1 UTSW 9 66089595 missense possibly damaging 0.90
R4975:Snx1 UTSW 9 66104905 nonsense probably null
R5043:Snx1 UTSW 9 66097436 missense probably benign 0.04
R6346:Snx1 UTSW 9 66094648 missense possibly damaging 0.62
T0722:Snx1 UTSW 9 66104927 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GGAATGTAGACTTGCTATAGCTTG -3'
(R):5'- GTCTAACTCAAACTGGGGCC -3'

Sequencing Primer
(F):5'- CTTGCTATAGCTTGATAAATAGGAGG -3'
(R):5'- CCAGCCAGCATCCGTAG -3'
Posted On2015-12-29