Incidental Mutation 'R4778:Rasgrf2'
ID368101
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91983661 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 626 (F626L)
Ref Sequence ENSEMBL: ENSMUSP00000096930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326]
Predicted Effect probably damaging
Transcript: ENSMUST00000099326
AA Change: F626L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: F626L

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect unknown
Transcript: ENSMUST00000142378
AA Change: F25L
SMART Domains Protein: ENSMUSP00000115401
Gene: ENSMUSG00000021708
AA Change: F25L

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
Blast:RasGEFN 187 249 8e-29 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000151408
AA Change: F25L
SMART Domains Protein: ENSMUSP00000116892
Gene: ENSMUSG00000021708
AA Change: F25L

DomainStartEndE-ValueType
RasGEFN 33 175 9.35e-15 SMART
RasGEFN 186 323 6.04e-9 SMART
RasGEF 349 586 2.97e-112 SMART
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem43 T C 6: 91,482,255 V236A probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6595:Rasgrf2 UTSW 13 92030853 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATATCCACAAAGCGGGAGTACC -3'
(R):5'- AACATCGCTCTGTCATCTGTG -3'

Sequencing Primer
(F):5'- AAAGGCCTCTTGTAGATGTCTGAGAG -3'
(R):5'- ATCGCTCTGTCATCTGTGGAAGAC -3'
Posted On2015-12-29