Incidental Mutation 'R4779:Rufy4'
ID368115
Institutional Source Beutler Lab
Gene Symbol Rufy4
Ensembl Gene ENSMUSG00000061815
Gene NameRUN and FYVE domain containing 4
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74125541-74148223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74147663 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 537 (C537R)
Ref Sequence ENSEMBL: ENSMUSP00000115873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080167] [ENSMUST00000127134]
Predicted Effect probably damaging
Transcript: ENSMUST00000080167
AA Change: C453R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079062
Gene: ENSMUSG00000061815
AA Change: C453R

DomainStartEndE-ValueType
Pfam:RUN 2 81 1.5e-8 PFAM
coiled coil region 331 404 N/A INTRINSIC
Blast:FYVE 415 472 2e-6 BLAST
SCOP:d1vfya_ 428 473 4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127134
AA Change: C537R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115873
Gene: ENSMUSG00000061815
AA Change: C537R

DomainStartEndE-ValueType
Pfam:RUN 41 165 6.2e-10 PFAM
coiled coil region 415 488 N/A INTRINSIC
Blast:FYVE 499 556 2e-6 BLAST
SCOP:d1vfya_ 512 557 3e-7 SMART
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Rufy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Rufy4 APN 1 74129354 missense probably damaging 1.00
IGL02075:Rufy4 APN 1 74129359 missense probably damaging 1.00
IGL02604:Rufy4 APN 1 74134189 missense probably damaging 1.00
IGL02606:Rufy4 APN 1 74133350 splice site probably benign
IGL02928:Rufy4 APN 1 74129082 unclassified probably benign
R0091:Rufy4 UTSW 1 74128936 unclassified probably benign
R0507:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R0589:Rufy4 UTSW 1 74132883 missense probably damaging 1.00
R0595:Rufy4 UTSW 1 74140930 missense possibly damaging 0.94
R0742:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R1533:Rufy4 UTSW 1 74129843 critical splice donor site probably null
R1666:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1668:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1827:Rufy4 UTSW 1 74134120 missense probably damaging 1.00
R2018:Rufy4 UTSW 1 74140947 missense possibly damaging 0.49
R2095:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2306:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2307:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2472:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2475:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3022:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3054:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3055:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3056:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3118:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3237:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3545:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3546:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3547:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3548:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3768:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3770:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3816:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3817:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3818:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3819:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3895:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4050:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4091:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4124:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4125:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4127:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4231:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4233:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4234:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4254:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4255:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4319:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4320:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4321:Rufy4 UTSW 1 74132784 missense possibly damaging 0.93
R4321:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4322:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4323:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4324:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4360:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4361:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4406:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4408:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4516:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4517:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4520:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4522:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4524:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4531:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4533:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4617:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4661:Rufy4 UTSW 1 74133107 missense probably damaging 0.99
R4778:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4840:Rufy4 UTSW 1 74129039 missense possibly damaging 0.82
R4897:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4898:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4899:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4915:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4917:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4918:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4997:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5092:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5097:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5189:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5191:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5195:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5196:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5197:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5226:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5227:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5228:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5230:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5372:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5373:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5374:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5375:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5376:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5377:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5378:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5699:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5748:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5750:Rufy4 UTSW 1 74132909 missense probably benign 0.01
R5767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5865:Rufy4 UTSW 1 74146755 missense probably damaging 0.99
R6083:Rufy4 UTSW 1 74129397 missense probably damaging 0.99
R6149:Rufy4 UTSW 1 74147733 missense probably benign 0.15
R6279:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6300:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6629:Rufy4 UTSW 1 74132367 intron probably null
R6809:Rufy4 UTSW 1 74133047 missense probably benign 0.00
R7179:Rufy4 UTSW 1 74132876 missense probably benign 0.12
R7218:Rufy4 UTSW 1 74133015 missense probably damaging 0.99
X0023:Rufy4 UTSW 1 74141049 missense probably benign 0.04
X0025:Rufy4 UTSW 1 74133019 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCATCAGGAGAAGCTGC -3'
(R):5'- AGAGCTAGGCCTATCTGTGG -3'

Sequencing Primer
(F):5'- GGAGAAGCTGCCACCTCAATTAG -3'
(R):5'- CTAGGCCTATCTGTGGACTGC -3'
Posted On2015-12-29