Incidental Mutation 'R4779:Lrp2'
ID368120
Institutional Source Beutler Lab
Gene Symbol Lrp2
Ensembl Gene ENSMUSG00000027070
Gene Namelow density lipoprotein receptor-related protein 2
SynonymsGp330, D230004K18Rik, b2b1625.2Clo, Megalin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4779 (G1)
Quality Score208
Status Validated
Chromosome2
Chromosomal Location69424340-69586065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69459715 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 3593 (H3593Q)
Ref Sequence ENSEMBL: ENSMUSP00000079752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080953]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080953
AA Change: H3593Q

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079752
Gene: ENSMUSG00000027070
AA Change: H3593Q

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
LDLa 27 64 5.63e-13 SMART
LDLa 66 105 2.25e-12 SMART
EGF 107 143 2.59e1 SMART
LDLa 107 144 9.29e-14 SMART
LDLa 146 181 6.18e-10 SMART
LDLa 182 219 1.08e-14 SMART
LDLa 221 258 1.05e-12 SMART
LDLa 264 302 1.66e-10 SMART
EGF 310 346 3.23e0 SMART
EGF 350 385 2.32e-1 SMART
LY 414 457 3.88e-3 SMART
LY 458 500 1.17e-6 SMART
LY 501 547 5.96e-13 SMART
LY 548 590 1.94e-12 SMART
LY 591 634 2.66e0 SMART
EGF 661 704 7.76e-3 SMART
LY 732 774 1.76e0 SMART
LY 775 817 3.64e-8 SMART
LY 818 860 1.11e-3 SMART
LY 861 903 2.11e-13 SMART
LY 905 946 9.33e-1 SMART
EGF 972 1013 1.73e0 SMART
LDLa 1024 1061 1.05e-12 SMART
LDLa 1065 1103 4.65e-14 SMART
LDLa 1109 1146 3.63e-16 SMART
LDLa 1149 1186 5.5e-16 SMART
LDLa 1187 1225 1.43e-14 SMART
LDLa 1230 1269 2.1e-12 SMART
LDLa 1271 1308 3.63e-16 SMART
LDLa 1312 1351 4.69e-10 SMART
EGF 1353 1390 9.7e-4 SMART
EGF_CA 1391 1430 6.54e-10 SMART
LY 1457 1501 1.43e-1 SMART
LY 1502 1544 2e-14 SMART
LY 1545 1590 3.03e-14 SMART
LY 1591 1633 5.48e-12 SMART
LY 1635 1677 1.18e-2 SMART
EGF 1704 1742 5.2e-4 SMART
LY 1771 1812 1.68e1 SMART
LY 1813 1856 1.91e-2 SMART
LY 1859 1911 1.88e-10 SMART
LY 1912 1954 7.69e-7 SMART
LY 1955 1994 3e1 SMART
EGF 2022 2060 1.18e-2 SMART
LY 2088 2135 1.14e1 SMART
LY 2136 2182 2.11e-4 SMART
LY 2183 2226 2.22e-12 SMART
LY 2227 2269 1.24e-10 SMART
EGF 2346 2384 2.07e1 SMART
LY 2459 2501 9.91e-10 SMART
LY 2503 2543 1.48e-8 SMART
LY 2544 2586 6.85e-13 SMART
LY 2587 2627 8.13e-1 SMART
EGF_like 2655 2694 3.5e1 SMART
LDLa 2700 2739 2.86e-14 SMART
LDLa 2741 2778 8.09e-14 SMART
LDLa 2780 2820 3.19e-12 SMART
LDLa 2822 2862 6.94e-13 SMART
LDLa 2864 2903 9.29e-14 SMART
LDLa 2907 2947 4.79e-16 SMART
LDLa 2949 2992 8.41e-12 SMART
LDLa 2994 3031 1.08e-14 SMART
LDLa 3033 3072 1.83e-12 SMART
LDLa 3076 3113 1.16e-14 SMART
EGF 3115 3153 8.57e-5 SMART
EGF_CA 3154 3194 3.56e-11 SMART
LY 3221 3263 9.77e-9 SMART
LY 3264 3306 1.22e-9 SMART
LY 3312 3358 5.44e-7 SMART
LY 3359 3401 1.83e-13 SMART
LY 3402 3443 1.41e-5 SMART
EGF 3470 3511 8.91e-3 SMART
LDLa 3513 3552 1.79e-15 SMART
LDLa 3554 3593 9.89e-9 SMART
LDLa 3595 3634 3.07e-14 SMART
LDLa 3636 3675 3.34e-15 SMART
LDLa 3679 3718 1.39e-12 SMART
LDLa 3720 3758 3.83e-15 SMART
LDLa 3760 3797 7.15e-15 SMART
LDLa 3799 3836 2.86e-14 SMART
LDLa 3843 3882 2.38e-11 SMART
LDLa 3884 3924 3.66e-12 SMART
LDLa 3929 3966 1.93e-11 SMART
EGF 3971 4008 6.3e-3 SMART
EGF_CA 4009 4050 1.36e-7 SMART
low complexity region 4072 4084 N/A INTRINSIC
LY 4136 4178 6.2e-11 SMART
LY 4179 4222 4.32e-10 SMART
LY 4223 4266 3.78e-15 SMART
LY 4267 4306 4.53e1 SMART
EGF 4335 4367 3.46e0 SMART
EGF 4368 4413 1.53e-1 SMART
transmembrane domain 4425 4447 N/A INTRINSIC
low complexity region 4454 4472 N/A INTRINSIC
low complexity region 4616 4636 N/A INTRINSIC
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, low density lipoprotein-related protein 2 (LRP2) or megalin, is a multi-ligand endocytic receptor that is expressed in many different tissues but primarily in absorptive epithilial tissues such as the kidney. This glycoprotein has a large amino-terminal extracellular domain, a single transmembrane domain, and a short carboxy-terminal cytoplasmic tail. The extracellular ligand-binding-domains bind diverse macromolecules including albumin, apolipoproteins B and E, and lipoprotein lipase. The LRP2 protein is critical for the reuptake of numerous ligands, including lipoproteins, sterols, vitamin-binding proteins, and hormones. This protein also has a role in cell-signaling; extracellular ligands include parathyroid horomones and the morphogen sonic hedgehog while cytosolic ligands include MAP kinase scaffold proteins and JNK interacting proteins. Recycling of this membrane receptor is regulated by phosphorylation of its cytoplasmic domain. Mutations in this gene cause Donnai-Barrow syndrome (DBS) and facio-oculoacoustico-renal syndrome (FOAR).[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lung and kidney epithelial defects, impaired B12 uptake, reduced proliferation of the neuroepithelium resulting in lack of olfactory bulbs, forebrain fusions, ventricular defects, and perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Lrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Lrp2 APN 2 69507779 missense probably damaging 1.00
IGL00594:Lrp2 APN 2 69486280 missense probably benign 0.00
IGL00782:Lrp2 APN 2 69501645 missense probably benign 0.14
IGL00821:Lrp2 APN 2 69459516 missense probably damaging 1.00
IGL00897:Lrp2 APN 2 69521881 missense possibly damaging 0.86
IGL01065:Lrp2 APN 2 69469436 missense possibly damaging 0.94
IGL01087:Lrp2 APN 2 69524073 missense probably damaging 1.00
IGL01095:Lrp2 APN 2 69492432 nonsense probably null
IGL01131:Lrp2 APN 2 69499239 missense probably damaging 1.00
IGL01350:Lrp2 APN 2 69510984 missense probably damaging 0.96
IGL01352:Lrp2 APN 2 69503526 missense possibly damaging 0.77
IGL01358:Lrp2 APN 2 69552470 splice site probably benign
IGL01375:Lrp2 APN 2 69478566 splice site probably benign
IGL01384:Lrp2 APN 2 69483502 missense probably damaging 1.00
IGL01384:Lrp2 APN 2 69453812 missense probably null 1.00
IGL01411:Lrp2 APN 2 69482267 missense probably damaging 1.00
IGL01418:Lrp2 APN 2 69525286 missense probably benign
IGL01444:Lrp2 APN 2 69443716 missense possibly damaging 0.94
IGL01464:Lrp2 APN 2 69472439 missense probably damaging 0.98
IGL01528:Lrp2 APN 2 69492460 missense probably damaging 1.00
IGL01663:Lrp2 APN 2 69428706 missense probably benign
IGL01761:Lrp2 APN 2 69481235 missense possibly damaging 0.85
IGL01780:Lrp2 APN 2 69486184 missense possibly damaging 0.66
IGL01994:Lrp2 APN 2 69483601 missense probably benign 0.08
IGL02015:Lrp2 APN 2 69527578 missense probably benign 0.00
IGL02104:Lrp2 APN 2 69510418 missense probably damaging 1.00
IGL02132:Lrp2 APN 2 69537616 missense probably benign 0.01
IGL02134:Lrp2 APN 2 69513379 critical splice acceptor site probably null
IGL02197:Lrp2 APN 2 69466880 missense probably benign 0.01
IGL02212:Lrp2 APN 2 69451264 missense probably benign 0.00
IGL02240:Lrp2 APN 2 69535046 missense probably benign
IGL02248:Lrp2 APN 2 69482808 missense probably damaging 1.00
IGL02369:Lrp2 APN 2 69464636 missense probably damaging 1.00
IGL02416:Lrp2 APN 2 69469633 missense probably damaging 1.00
IGL02417:Lrp2 APN 2 69461305 missense probably damaging 1.00
IGL02458:Lrp2 APN 2 69521773 missense probably damaging 0.97
IGL02479:Lrp2 APN 2 69464801 splice site probably benign
IGL02508:Lrp2 APN 2 69503430 missense probably benign 0.04
IGL02751:Lrp2 APN 2 69533462 missense possibly damaging 0.56
IGL02814:Lrp2 APN 2 69506736 missense probably damaging 1.00
IGL02867:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02889:Lrp2 APN 2 69552450 missense possibly damaging 0.67
IGL02943:Lrp2 APN 2 69455510 missense possibly damaging 0.86
IGL02948:Lrp2 APN 2 69487837 missense probably damaging 1.00
IGL02960:Lrp2 APN 2 69455453 splice site probably benign
IGL02990:Lrp2 APN 2 69441396 missense possibly damaging 0.56
IGL03027:Lrp2 APN 2 69537553 missense probably benign 0.43
IGL03038:Lrp2 APN 2 69475464 missense probably damaging 0.99
IGL03064:Lrp2 APN 2 69483133 missense probably damaging 0.98
IGL03107:Lrp2 APN 2 69454833 missense probably damaging 1.00
IGL03141:Lrp2 APN 2 69477026 missense probably damaging 0.99
IGL03154:Lrp2 APN 2 69549042 missense probably damaging 1.00
IGL03155:Lrp2 APN 2 69455452 splice site probably benign
IGL03163:Lrp2 APN 2 69501526 nonsense probably null
IGL03164:Lrp2 APN 2 69464699 missense probably damaging 1.00
IGL03169:Lrp2 APN 2 69523194 missense probably damaging 1.00
IGL03174:Lrp2 APN 2 69466265 missense probably damaging 1.00
IGL03189:Lrp2 APN 2 69438478 splice site probably benign
IGL03288:Lrp2 APN 2 69426039 missense probably benign 0.02
IGL03350:Lrp2 APN 2 69438453 missense probably damaging 1.00
IGL03378:Lrp2 APN 2 69431152 missense probably damaging 1.00
casual UTSW 2 69499263 missense probably benign
relaxed UTSW 2 69535005 missense probably damaging 1.00
unintended UTSW 2 69518443 missense probably damaging 1.00
IGL02835:Lrp2 UTSW 2 69505304 missense probably damaging 1.00
IGL03055:Lrp2 UTSW 2 69458448 missense probably damaging 1.00
PIT4362001:Lrp2 UTSW 2 69537538 missense probably damaging 1.00
PIT4504001:Lrp2 UTSW 2 69475403 missense probably damaging 1.00
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0008:Lrp2 UTSW 2 69516551 missense probably benign 0.42
R0044:Lrp2 UTSW 2 69527555 missense probably damaging 0.96
R0044:Lrp2 UTSW 2 69527555 missense probably benign 0.01
R0048:Lrp2 UTSW 2 69465627 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0098:Lrp2 UTSW 2 69475412 missense probably damaging 1.00
R0103:Lrp2 UTSW 2 69477040 missense probably benign
R0167:Lrp2 UTSW 2 69425658 missense possibly damaging 0.95
R0226:Lrp2 UTSW 2 69537563 missense probably null 1.00
R0243:Lrp2 UTSW 2 69428630 missense probably benign 0.00
R0308:Lrp2 UTSW 2 69482982 splice site probably benign
R0323:Lrp2 UTSW 2 69469639 missense probably damaging 1.00
R0372:Lrp2 UTSW 2 69535043 missense probably benign 0.10
R0374:Lrp2 UTSW 2 69430307 missense probably damaging 1.00
R0391:Lrp2 UTSW 2 69456858 missense probably damaging 0.99
R0391:Lrp2 UTSW 2 69460337 splice site probably benign
R0395:Lrp2 UTSW 2 69433077 missense possibly damaging 0.89
R0401:Lrp2 UTSW 2 69479148 missense probably damaging 0.98
R0471:Lrp2 UTSW 2 69525234 missense probably damaging 0.97
R0483:Lrp2 UTSW 2 69507801 missense probably damaging 0.99
R0502:Lrp2 UTSW 2 69511017 missense probably damaging 1.00
R0542:Lrp2 UTSW 2 69428654 missense probably benign 0.00
R0544:Lrp2 UTSW 2 69491931 missense probably benign 0.18
R0548:Lrp2 UTSW 2 69537638 splice site probably benign
R0593:Lrp2 UTSW 2 69467006 missense probably benign
R0608:Lrp2 UTSW 2 69486243 missense probably benign 0.02
R0633:Lrp2 UTSW 2 69448120 missense probably damaging 1.00
R0691:Lrp2 UTSW 2 69451380 missense probably benign 0.19
R0718:Lrp2 UTSW 2 69510948 missense probably damaging 1.00
R0737:Lrp2 UTSW 2 69448169 missense probably damaging 0.96
R0771:Lrp2 UTSW 2 69507990 missense probably damaging 1.00
R0784:Lrp2 UTSW 2 69518365 missense probably benign 0.32
R0885:Lrp2 UTSW 2 69482353 missense possibly damaging 0.75
R0947:Lrp2 UTSW 2 69487838 missense probably damaging 1.00
R1235:Lrp2 UTSW 2 69524036 missense probably damaging 1.00
R1293:Lrp2 UTSW 2 69523302 unclassified probably null
R1301:Lrp2 UTSW 2 69428604 missense probably damaging 0.98
R1387:Lrp2 UTSW 2 69456918 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69460477 missense probably damaging 1.00
R1459:Lrp2 UTSW 2 69483394 missense probably damaging 0.99
R1529:Lrp2 UTSW 2 69523182 missense probably damaging 1.00
R1543:Lrp2 UTSW 2 69500730 missense probably damaging 1.00
R1546:Lrp2 UTSW 2 69502610 missense probably damaging 1.00
R1550:Lrp2 UTSW 2 69502661 missense possibly damaging 0.74
R1590:Lrp2 UTSW 2 69466763 critical splice donor site probably null
R1689:Lrp2 UTSW 2 69503529 missense probably benign 0.09
R1693:Lrp2 UTSW 2 69510418 missense probably damaging 1.00
R1753:Lrp2 UTSW 2 69496489 missense possibly damaging 0.87
R1799:Lrp2 UTSW 2 69503530 missense probably benign 0.04
R1834:Lrp2 UTSW 2 69466880 missense probably benign 0.01
R1921:Lrp2 UTSW 2 69523287 missense probably damaging 1.00
R2000:Lrp2 UTSW 2 69467090 missense probably damaging 1.00
R2077:Lrp2 UTSW 2 69507843 missense probably damaging 1.00
R2092:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2093:Lrp2 UTSW 2 69536021 missense probably benign 0.25
R2108:Lrp2 UTSW 2 69506624 missense possibly damaging 0.75
R2117:Lrp2 UTSW 2 69483385 missense probably benign 0.05
R2122:Lrp2 UTSW 2 69483707 missense probably damaging 1.00
R2134:Lrp2 UTSW 2 69511067 missense probably damaging 1.00
R2207:Lrp2 UTSW 2 69467028 missense possibly damaging 0.94
R2248:Lrp2 UTSW 2 69511010 missense probably damaging 1.00
R2264:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R2316:Lrp2 UTSW 2 69491847 missense possibly damaging 0.75
R2513:Lrp2 UTSW 2 69506374 splice site probably null
R2984:Lrp2 UTSW 2 69425814 splice site probably null
R3085:Lrp2 UTSW 2 69467135 missense probably benign 0.05
R3103:Lrp2 UTSW 2 69431984 missense probably benign 0.00
R3727:Lrp2 UTSW 2 69510429 missense probably damaging 1.00
R3730:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3730:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3731:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3731:Lrp2 UTSW 2 69534907 critical splice donor site probably null
R3764:Lrp2 UTSW 2 69496336 missense probably damaging 1.00
R3768:Lrp2 UTSW 2 69505105 missense probably benign 0.34
R3778:Lrp2 UTSW 2 69509204 missense probably benign 0.00
R3808:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3809:Lrp2 UTSW 2 69501548 missense probably damaging 1.00
R3813:Lrp2 UTSW 2 69464579 missense probably damaging 0.99
R3828:Lrp2 UTSW 2 69426012 missense probably benign 0.03
R3852:Lrp2 UTSW 2 69537565 missense probably damaging 0.96
R3877:Lrp2 UTSW 2 69459472 critical splice donor site probably null
R3877:Lrp2 UTSW 2 69549047 missense probably damaging 1.00
R3922:Lrp2 UTSW 2 69506376 missense probably benign
R4081:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4082:Lrp2 UTSW 2 69513273 missense probably damaging 0.98
R4118:Lrp2 UTSW 2 69430262 critical splice donor site probably null
R4193:Lrp2 UTSW 2 69467143 missense probably damaging 1.00
R4284:Lrp2 UTSW 2 69480094 missense possibly damaging 0.95
R4322:Lrp2 UTSW 2 69425991 nonsense probably null
R4352:Lrp2 UTSW 2 69432182 critical splice donor site probably null
R4407:Lrp2 UTSW 2 69502517 missense probably damaging 1.00
R4408:Lrp2 UTSW 2 69467169 missense probably benign 0.09
R4416:Lrp2 UTSW 2 69527231 missense probably benign 0.18
R4426:Lrp2 UTSW 2 69506348 missense probably benign 0.00
R4510:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4511:Lrp2 UTSW 2 69480062 missense possibly damaging 0.58
R4553:Lrp2 UTSW 2 69513285 missense probably benign 0.13
R4591:Lrp2 UTSW 2 69536075 missense probably damaging 1.00
R4612:Lrp2 UTSW 2 69458427 nonsense probably null
R4622:Lrp2 UTSW 2 69460349 missense possibly damaging 0.87
R4632:Lrp2 UTSW 2 69489129 splice site probably null
R4633:Lrp2 UTSW 2 69461417 missense probably benign 0.16
R4636:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R4657:Lrp2 UTSW 2 69466993 missense probably damaging 1.00
R4667:Lrp2 UTSW 2 69489298 missense probably benign 0.02
R4712:Lrp2 UTSW 2 69506551 missense probably damaging 1.00
R4713:Lrp2 UTSW 2 69487966 missense probably damaging 1.00
R4720:Lrp2 UTSW 2 69481173 missense probably damaging 0.99
R4732:Lrp2 UTSW 2 69533555 missense probably benign
R4733:Lrp2 UTSW 2 69533555 missense probably benign
R4777:Lrp2 UTSW 2 69482264 missense probably damaging 1.00
R4786:Lrp2 UTSW 2 69537956 missense probably damaging 1.00
R4842:Lrp2 UTSW 2 69469411 missense probably benign 0.06
R4845:Lrp2 UTSW 2 69509241 missense possibly damaging 0.71
R4846:Lrp2 UTSW 2 69479113 missense probably damaging 1.00
R4938:Lrp2 UTSW 2 69472368 missense probably damaging 0.98
R4951:Lrp2 UTSW 2 69535988 missense probably damaging 1.00
R4990:Lrp2 UTSW 2 69481388 missense probably benign 0.01
R5075:Lrp2 UTSW 2 69465758 missense probably benign 0.00
R5078:Lrp2 UTSW 2 69501530 missense possibly damaging 0.93
R5102:Lrp2 UTSW 2 69489158 missense probably damaging 0.98
R5124:Lrp2 UTSW 2 69501490 missense probably damaging 0.97
R5131:Lrp2 UTSW 2 69430342 missense possibly damaging 0.74
R5141:Lrp2 UTSW 2 69552349 splice site probably null
R5223:Lrp2 UTSW 2 69524053 missense probably damaging 0.99
R5236:Lrp2 UTSW 2 69456819 splice site probably null
R5267:Lrp2 UTSW 2 69548978 missense possibly damaging 0.83
R5290:Lrp2 UTSW 2 69513354 missense probably damaging 1.00
R5333:Lrp2 UTSW 2 69525228 missense probably benign 0.01
R5355:Lrp2 UTSW 2 69454838 nonsense probably null
R5356:Lrp2 UTSW 2 69464708 missense possibly damaging 0.74
R5369:Lrp2 UTSW 2 69459560 missense probably benign 0.04
R5486:Lrp2 UTSW 2 69437465 missense probably benign 0.04
R5554:Lrp2 UTSW 2 69552424 missense possibly damaging 0.92
R5584:Lrp2 UTSW 2 69451288 missense probably damaging 1.00
R5585:Lrp2 UTSW 2 69464624 missense possibly damaging 0.77
R5587:Lrp2 UTSW 2 69499263 missense probably benign
R5605:Lrp2 UTSW 2 69523299 missense probably damaging 1.00
R5637:Lrp2 UTSW 2 69472418 missense probably damaging 1.00
R5647:Lrp2 UTSW 2 69519914 missense probably null 0.80
R5686:Lrp2 UTSW 2 69511061 missense possibly damaging 0.88
R5691:Lrp2 UTSW 2 69502553 missense probably damaging 1.00
R5724:Lrp2 UTSW 2 69451382 missense probably damaging 0.99
R5726:Lrp2 UTSW 2 69509147 missense probably damaging 1.00
R5743:Lrp2 UTSW 2 69466877 missense probably damaging 1.00
R5777:Lrp2 UTSW 2 69455525 missense probably damaging 1.00
R5841:Lrp2 UTSW 2 69480153 missense probably benign 0.00
R5892:Lrp2 UTSW 2 69442776 missense probably benign
R5951:Lrp2 UTSW 2 69496323 splice site probably null
R5974:Lrp2 UTSW 2 69459548 missense probably damaging 1.00
R5980:Lrp2 UTSW 2 69535005 missense probably damaging 1.00
R6046:Lrp2 UTSW 2 69506754 missense probably damaging 1.00
R6113:Lrp2 UTSW 2 69483557 missense possibly damaging 0.76
R6146:Lrp2 UTSW 2 69511001 missense probably benign 0.00
R6177:Lrp2 UTSW 2 69510419 frame shift probably null
R6180:Lrp2 UTSW 2 69503524 missense possibly damaging 0.85
R6219:Lrp2 UTSW 2 69469478 missense probably damaging 1.00
R6228:Lrp2 UTSW 2 69482366 missense possibly damaging 0.88
R6265:Lrp2 UTSW 2 69466340 missense probably damaging 1.00
R6312:Lrp2 UTSW 2 69436681 missense probably damaging 1.00
R6337:Lrp2 UTSW 2 69438467 missense probably damaging 1.00
R6376:Lrp2 UTSW 2 69483443 missense probably benign 0.02
R6385:Lrp2 UTSW 2 69495784 missense probably benign 0.22
R6429:Lrp2 UTSW 2 69461287 missense probably damaging 1.00
R6458:Lrp2 UTSW 2 69505156 missense probably benign 0.00
R6524:Lrp2 UTSW 2 69436639 missense possibly damaging 0.93
R6555:Lrp2 UTSW 2 69509303 missense probably benign 0.00
R6594:Lrp2 UTSW 2 69439923 missense possibly damaging 0.58
R6599:Lrp2 UTSW 2 69469405 missense probably damaging 1.00
R6655:Lrp2 UTSW 2 69453858 missense probably benign 0.01
R6718:Lrp2 UTSW 2 69483780 missense probably benign 0.09
R6736:Lrp2 UTSW 2 69448211 missense probably benign 0.02
R6738:Lrp2 UTSW 2 69458488 missense probably damaging 0.97
R6799:Lrp2 UTSW 2 69483904 missense probably damaging 1.00
R6846:Lrp2 UTSW 2 69518443 missense probably damaging 1.00
R6856:Lrp2 UTSW 2 69513268 missense probably damaging 1.00
R6861:Lrp2 UTSW 2 69513377 missense possibly damaging 0.77
R6888:Lrp2 UTSW 2 69524141 missense probably damaging 0.98
R6897:Lrp2 UTSW 2 69510502 missense probably benign
R6902:Lrp2 UTSW 2 69459503 missense probably damaging 1.00
R6908:Lrp2 UTSW 2 69472365 missense probably damaging 1.00
R6918:Lrp2 UTSW 2 69489305 missense probably damaging 1.00
R6989:Lrp2 UTSW 2 69472455 missense probably damaging 1.00
R7022:Lrp2 UTSW 2 69483208 missense probably damaging 1.00
R7025:Lrp2 UTSW 2 69483028 missense possibly damaging 0.90
R7026:Lrp2 UTSW 2 69521787 missense probably damaging 0.97
R7138:Lrp2 UTSW 2 69465745 missense possibly damaging 0.94
R7145:Lrp2 UTSW 2 69454808 critical splice donor site probably null
R7150:Lrp2 UTSW 2 69488051 missense probably damaging 0.99
X0011:Lrp2 UTSW 2 69519998 missense probably damaging 1.00
X0023:Lrp2 UTSW 2 69436600 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTACGTCACACTTCCAGC -3'
(R):5'- AAGGGCATGAACTCACAAGTC -3'

Sequencing Primer
(F):5'- ACACTTCCAGCTCTGCGG -3'
(R):5'- GCATGAACTCACAAGTCTGATAAAAG -3'
Posted On2015-12-29