Incidental Mutation 'R4779:Ptpra'
ID368123
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Nameprotein tyrosine phosphatase, receptor type, A
SynonymsPTPalpha, RPTRalpha, Ptpa, PTP[a], RPTPalpha
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130450278-130556124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 130537617 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 364 (V364I)
Ref Sequence ENSEMBL: ENSMUSP00000076533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303] [ENSMUST00000230981]
PDB Structure
Crystal structure of the D2 domain of RPTPa [X-RAY DIFFRACTION]
RECEPTOR PROTEIN TYROSINE PHOSPHATASE ALPHA, DOMAIN 1 FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028769
AA Change: V328I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: V328I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 494 6.01e-130 SMART
PTPc 523 784 3.56e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077303
AA Change: V364I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: V364I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 530 2.03e-118 SMART
PTPc 559 820 3.56e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230640
Predicted Effect probably damaging
Transcript: ENSMUST00000230981
AA Change: V337I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130544439 missense probably damaging 1.00
IGL01734:Ptpra APN 2 130544077 missense probably damaging 1.00
IGL02218:Ptpra APN 2 130552335 splice site probably benign
IGL02385:Ptpra APN 2 130540473 unclassified probably benign
IGL02480:Ptpra APN 2 130504261 missense probably benign 0.09
IGL03181:Ptpra APN 2 130517787 missense probably damaging 0.99
R0374:Ptpra UTSW 2 130537621 missense probably damaging 1.00
R0483:Ptpra UTSW 2 130539685 missense probably damaging 1.00
R0848:Ptpra UTSW 2 130518991 missense probably damaging 1.00
R1550:Ptpra UTSW 2 130541393 missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130544952 missense probably damaging 1.00
R1689:Ptpra UTSW 2 130503492 missense probably benign 0.01
R1760:Ptpra UTSW 2 130549827 missense probably damaging 1.00
R1943:Ptpra UTSW 2 130544104 missense probably damaging 1.00
R2114:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2115:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2117:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2187:Ptpra UTSW 2 130504299 missense probably benign
R2848:Ptpra UTSW 2 130544999 missense probably benign 0.06
R2849:Ptpra UTSW 2 130544999 missense probably benign 0.06
R4644:Ptpra UTSW 2 130544158 missense probably damaging 1.00
R4849:Ptpra UTSW 2 130532161 missense probably damaging 1.00
R4899:Ptpra UTSW 2 130544436 missense probably damaging 1.00
R5657:Ptpra UTSW 2 130504284 missense probably benign 0.06
R6018:Ptpra UTSW 2 130503502 missense probably benign
R6234:Ptpra UTSW 2 130537588 missense probably damaging 1.00
R6350:Ptpra UTSW 2 130540592 missense probably damaging 1.00
R6856:Ptpra UTSW 2 130519381 missense probably damaging 1.00
R7072:Ptpra UTSW 2 130553430 missense probably damaging 1.00
R7146:Ptpra UTSW 2 130537651 critical splice donor site probably null
R7220:Ptpra UTSW 2 130544497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGAAACATTCACTTGTCAGG -3'
(R):5'- AGAGACACATTAGCCTGCCTG -3'

Sequencing Primer
(F):5'- TGGATAATAAGGTGGATATCCCCCTG -3'
(R):5'- CTGCCTGGACAATCTACTAGTGGAG -3'
Posted On2015-12-29