Incidental Mutation 'R4779:Chd6'
ID368126
Institutional Source Beutler Lab
Gene Symbol Chd6
Ensembl Gene ENSMUSG00000057133
Gene Namechromodomain helicase DNA binding protein 6
Synonyms6330406J24Rik, 5430439G14Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R4779 (G1)
Quality Score223
Status Validated
Chromosome2
Chromosomal Location160946978-161109075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 160949557 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2627 (S2627T)
Ref Sequence ENSEMBL: ENSMUSP00000042291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039782]
Predicted Effect probably damaging
Transcript: ENSMUST00000039782
AA Change: S2627T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: S2627T

DomainStartEndE-ValueType
low complexity region 86 106 N/A INTRINSIC
low complexity region 113 143 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
CHROMO 289 355 1.35e-4 SMART
CHROMO 372 430 3.48e-7 SMART
DEXDc 456 658 1.73e-39 SMART
HELICc 812 896 3.84e-23 SMART
low complexity region 1080 1094 N/A INTRINSIC
Blast:DEXDc 1108 1153 4e-23 BLAST
SANT 1445 1504 1.51e0 SMART
low complexity region 1866 1875 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2130 2140 N/A INTRINSIC
low complexity region 2277 2290 N/A INTRINSIC
low complexity region 2333 2349 N/A INTRINSIC
low complexity region 2437 2446 N/A INTRINSIC
low complexity region 2539 2563 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Chd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Chd6 APN 2 161042079 missense probably benign 0.01
IGL00899:Chd6 APN 2 161029298 splice site probably benign
IGL01104:Chd6 APN 2 160961927 missense probably damaging 1.00
IGL01295:Chd6 APN 2 160988370 splice site probably benign
IGL01717:Chd6 APN 2 160965259 missense possibly damaging 0.96
IGL01795:Chd6 APN 2 160961374 missense probably benign 0.00
IGL01814:Chd6 APN 2 161059929 missense probably benign 0.25
IGL02016:Chd6 APN 2 160983678 missense probably damaging 1.00
IGL02104:Chd6 APN 2 160977512 missense probably benign
IGL02158:Chd6 APN 2 161026292 missense possibly damaging 0.73
IGL02313:Chd6 APN 2 160965675 missense probably damaging 1.00
IGL02472:Chd6 APN 2 160984452 splice site probably benign
IGL02522:Chd6 APN 2 160965796 missense probably benign 0.30
IGL02626:Chd6 APN 2 161039350 splice site probably benign
IGL02727:Chd6 APN 2 160969463 missense probably damaging 0.96
IGL02738:Chd6 APN 2 160965698 missense probably benign 0.45
IGL02743:Chd6 APN 2 160960263 missense probably damaging 1.00
IGL02800:Chd6 APN 2 160984632 missense probably damaging 1.00
IGL02811:Chd6 APN 2 160990301 missense probably damaging 1.00
IGL02850:Chd6 APN 2 161019616 nonsense probably null
IGL02979:Chd6 APN 2 160966170 missense possibly damaging 0.48
IGL02993:Chd6 APN 2 161052384 splice site probably benign
IGL03277:Chd6 APN 2 160983061 missense probably null 1.00
IGL03346:Chd6 APN 2 160960362 missense probably benign 0.00
IGL03357:Chd6 APN 2 161018016 splice site probably benign
IGL03134:Chd6 UTSW 2 160965483 missense possibly damaging 0.88
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0106:Chd6 UTSW 2 160967902 missense probably damaging 1.00
R0212:Chd6 UTSW 2 161052847 missense probably damaging 0.99
R0363:Chd6 UTSW 2 161014324 missense probably damaging 1.00
R0399:Chd6 UTSW 2 161052688 missense probably damaging 1.00
R0511:Chd6 UTSW 2 160992191 missense probably damaging 0.99
R0771:Chd6 UTSW 2 161019580 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1147:Chd6 UTSW 2 160990271 missense probably damaging 1.00
R1184:Chd6 UTSW 2 161030802 missense probably damaging 1.00
R1277:Chd6 UTSW 2 160967815 missense probably damaging 1.00
R1396:Chd6 UTSW 2 160983103 missense probably damaging 1.00
R1647:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1648:Chd6 UTSW 2 161042058 missense probably damaging 1.00
R1745:Chd6 UTSW 2 160981667 missense probably damaging 0.96
R1766:Chd6 UTSW 2 160966639 missense probably damaging 1.00
R1871:Chd6 UTSW 2 160990256 missense probably damaging 1.00
R1928:Chd6 UTSW 2 160968000 splice site probably benign
R1973:Chd6 UTSW 2 160966387 missense probably damaging 0.99
R2200:Chd6 UTSW 2 160983753 missense probably damaging 1.00
R2340:Chd6 UTSW 2 160965759 frame shift probably null
R2341:Chd6 UTSW 2 160965759 frame shift probably null
R2519:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R2919:Chd6 UTSW 2 160967880 missense possibly damaging 0.89
R3025:Chd6 UTSW 2 160966552 small deletion probably benign
R3426:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R3427:Chd6 UTSW 2 160990255 missense probably damaging 1.00
R4042:Chd6 UTSW 2 160988333 missense probably damaging 1.00
R4273:Chd6 UTSW 2 160961291 missense probably benign 0.04
R4360:Chd6 UTSW 2 160949856 missense possibly damaging 0.48
R4399:Chd6 UTSW 2 160965318 missense probably benign
R4458:Chd6 UTSW 2 161029876 missense possibly damaging 0.66
R4583:Chd6 UTSW 2 161014194 missense probably damaging 1.00
R4625:Chd6 UTSW 2 160969492 missense probably damaging 1.00
R4740:Chd6 UTSW 2 160970183 missense probably benign
R4765:Chd6 UTSW 2 160966244 nonsense probably null
R4877:Chd6 UTSW 2 161029299 splice site probably benign
R5068:Chd6 UTSW 2 160966369 missense possibly damaging 0.54
R5215:Chd6 UTSW 2 160949953 missense probably damaging 1.00
R5275:Chd6 UTSW 2 160969363 missense probably benign
R5405:Chd6 UTSW 2 160965390 missense probably benign
R5598:Chd6 UTSW 2 161014112 missense probably damaging 1.00
R5693:Chd6 UTSW 2 160965265 missense probably benign
R5697:Chd6 UTSW 2 161018051 missense probably damaging 1.00
R5715:Chd6 UTSW 2 160949878 missense probably benign 0.00
R5759:Chd6 UTSW 2 160983762 missense possibly damaging 0.91
R5761:Chd6 UTSW 2 160957078 missense probably damaging 1.00
R5761:Chd6 UTSW 2 160957079 missense probably damaging 1.00
R5954:Chd6 UTSW 2 160965827 missense probably benign 0.00
R6025:Chd6 UTSW 2 160965582 missense probably benign
R6104:Chd6 UTSW 2 161014132 missense probably damaging 1.00
R6247:Chd6 UTSW 2 160950048 missense probably damaging 1.00
R6393:Chd6 UTSW 2 160979487 missense probably damaging 1.00
R6452:Chd6 UTSW 2 160965498 missense possibly damaging 0.76
R6468:Chd6 UTSW 2 161013067 missense probably damaging 1.00
R6784:Chd6 UTSW 2 160966254 missense probably damaging 1.00
R6803:Chd6 UTSW 2 160960359 missense possibly damaging 0.64
R6869:Chd6 UTSW 2 160965730 missense probably benign
R6895:Chd6 UTSW 2 160988340 missense probably damaging 1.00
R6925:Chd6 UTSW 2 161013127 missense probably damaging 0.98
Z1088:Chd6 UTSW 2 160966488 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCGGTGCAGTTCTGATCACTG -3'
(R):5'- TCAGCGTCTCTTGCAAGCAC -3'

Sequencing Primer
(F):5'- AGTTCTGATCACTGCCTGGC -3'
(R):5'- AAGTGGTACCTCAGCCACTG -3'
Posted On2015-12-29