Incidental Mutation 'R4779:Tshz3'
ID368146
Institutional Source Beutler Lab
Gene Symbol Tshz3
Ensembl Gene ENSMUSG00000021217
Gene Nameteashirt zinc finger family member 3
SynonymsTsh3, teashirt3, A630038G13Rik, Zfp537
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location36698118-36773553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36768972 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 129 (S129P)
Ref Sequence ENSEMBL: ENSMUSP00000021641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021641]
Predicted Effect probably damaging
Transcript: ENSMUST00000021641
AA Change: S129P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021641
Gene: ENSMUSG00000021217
AA Change: S129P

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
low complexity region 142 164 N/A INTRINSIC
ZnF_C2H2 214 238 1.86e0 SMART
ZnF_C2H2 275 299 3.83e-2 SMART
low complexity region 313 334 N/A INTRINSIC
ZnF_C2H2 386 410 5.62e0 SMART
low complexity region 483 497 N/A INTRINSIC
coiled coil region 609 630 N/A INTRINSIC
low complexity region 796 832 N/A INTRINSIC
low complexity region 855 872 N/A INTRINSIC
HOX 890 964 2.55e-4 SMART
ZnF_C2H2 976 998 8.09e0 SMART
ZnF_C2H2 1041 1064 2.4e-3 SMART
Meta Mutation Damage Score 0.076 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcription factor that regulates smooth muscle cell differentiation in the developing urinary tract. Consistent with this role, mice in which this gene has been inactivated exhibit abnormal gene expression in urinary tract smooth muscle cell precursors and kidney defects including hydronephrosis. The encoded transcription factor comprises a gene silencing complex that inhibits caspase expression. Reduced expression of this gene and consequent caspase upregulation may be correlated with progression of Alzheimer's disease in human patients. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit neoatal lethality likely due to respiratory distress and hydroureter and hydronephrosis associated with impaired development of ureteric smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Tshz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Tshz3 APN 7 36769960 missense probably damaging 0.97
IGL01922:Tshz3 APN 7 36769605 missense probably damaging 1.00
IGL02047:Tshz3 APN 7 36770468 missense probably damaging 1.00
IGL02166:Tshz3 APN 7 36768921 missense probably benign 0.00
IGL02405:Tshz3 APN 7 36769650 missense possibly damaging 0.93
IGL02658:Tshz3 APN 7 36769158 missense probably damaging 0.99
IGL02968:Tshz3 APN 7 36769824 missense probably damaging 1.00
IGL03073:Tshz3 APN 7 36770745 missense probably damaging 1.00
IGL03233:Tshz3 APN 7 36770079 missense probably damaging 0.97
IGL03296:Tshz3 APN 7 36771336 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0090:Tshz3 UTSW 7 36768892 missense probably benign
R0329:Tshz3 UTSW 7 36770033 missense probably benign
R0330:Tshz3 UTSW 7 36770033 missense probably benign
R0360:Tshz3 UTSW 7 36770533 missense probably benign
R0364:Tshz3 UTSW 7 36770533 missense probably benign
R0380:Tshz3 UTSW 7 36771300 missense probably damaging 1.00
R0547:Tshz3 UTSW 7 36771417 missense probably damaging 1.00
R1061:Tshz3 UTSW 7 36768706 missense probably damaging 1.00
R1618:Tshz3 UTSW 7 36771796 missense probably damaging 1.00
R1704:Tshz3 UTSW 7 36771360 missense possibly damaging 0.92
R1881:Tshz3 UTSW 7 36771654 missense possibly damaging 0.87
R1926:Tshz3 UTSW 7 36769375 missense probably damaging 1.00
R1994:Tshz3 UTSW 7 36769822 missense probably damaging 0.99
R2404:Tshz3 UTSW 7 36770380 missense probably damaging 0.99
R2447:Tshz3 UTSW 7 36768753 missense probably benign 0.00
R2930:Tshz3 UTSW 7 36771592 missense possibly damaging 0.74
R3879:Tshz3 UTSW 7 36771537 nonsense probably null
R4033:Tshz3 UTSW 7 36770584 missense possibly damaging 0.71
R4212:Tshz3 UTSW 7 36770119 missense probably damaging 1.00
R4394:Tshz3 UTSW 7 36769605 missense probably damaging 1.00
R4977:Tshz3 UTSW 7 36771190 missense probably benign 0.31
R5139:Tshz3 UTSW 7 36771025 missense probably benign 0.23
R5448:Tshz3 UTSW 7 36771229 missense possibly damaging 0.90
R5516:Tshz3 UTSW 7 36770350 missense probably benign 0.03
R5760:Tshz3 UTSW 7 36771569 missense probably damaging 1.00
R6360:Tshz3 UTSW 7 36769441 missense probably damaging 1.00
R6481:Tshz3 UTSW 7 36752339 intron probably null
R6535:Tshz3 UTSW 7 36768789 missense probably damaging 1.00
R7105:Tshz3 UTSW 7 36769756 missense probably damaging 1.00
R7133:Tshz3 UTSW 7 36770569 missense probably benign 0.12
R7225:Tshz3 UTSW 7 36769657 missense probably damaging 1.00
R7238:Tshz3 UTSW 7 36770097 missense probably damaging 1.00
X0067:Tshz3 UTSW 7 36768796 missense probably benign 0.19
X0067:Tshz3 UTSW 7 36769321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGCGAGTCTCACATCAG -3'
(R):5'- AAATGGAGCCGTACAGCTTG -3'

Sequencing Primer
(F):5'- CATCAGTGAGACGAGTGACC -3'
(R):5'- TGCACGGTGCTGAACAG -3'
Posted On2015-12-29