Incidental Mutation 'R4779:Cspg4'
ID368160
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Namechondroitin sulfate proteoglycan 4
SynonymsAN2, 4732461B14Rik, NG2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56865033-56899870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56885808 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 276 (N276Y)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
Predicted Effect probably damaging
Transcript: ENSMUST00000035661
AA Change: N276Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: N276Y

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215666
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Cntnap1 T A 11: 101,178,072 I147N possibly damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0602:Cspg4 UTSW 9 56888017 missense probably damaging 1.00
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1670:Cspg4 UTSW 9 56897403 missense probably damaging 1.00
R1721:Cspg4 UTSW 9 56888743 missense probably damaging 0.98
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R1975:Cspg4 UTSW 9 56890478 missense probably damaging 1.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4884:Cspg4 UTSW 9 56898069 missense probably benign 0.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6140:Cspg4 UTSW 9 56897224 missense probably benign 0.35
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6967:Cspg4 UTSW 9 56890136 missense possibly damaging 0.52
R6981:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGAAGAATTCTCTGCTGG -3'
(R):5'- TACCAGGGAGATATTGGCAGC -3'

Sequencing Primer
(F):5'- AAGAATTCTCTGCTGGTGATGAAG -3'
(R):5'- AGATATTGGCAGCCCCCG -3'
Posted On2015-12-29