Incidental Mutation 'R4779:Cntnap1'
ID368169
Institutional Source Beutler Lab
Gene Symbol Cntnap1
Ensembl Gene ENSMUSG00000017167
Gene Namecontactin associated protein-like 1
SynonymsNrxn4, Caspr, NCP1, p190, paranodin, shm
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R4779 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101170523-101190724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101178072 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 147 (I147N)
Ref Sequence ENSEMBL: ENSMUSP00000099398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062759] [ENSMUST00000103109]
Predicted Effect probably benign
Transcript: ENSMUST00000062759
SMART Domains Protein: ENSMUSP00000062588
Gene: ENSMUSG00000044052

DomainStartEndE-ValueType
Pfam:7tm_1 58 310 4.8e-43 PFAM
low complexity region 313 329 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103109
AA Change: I147N

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167
AA Change: I147N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FA58C 25 169 7.49e-36 SMART
LamG 196 333 2.86e-32 SMART
LamG 382 516 3.49e-27 SMART
EGF 544 578 2.28e0 SMART
Blast:FBG 580 777 1e-133 BLAST
LamG 806 940 1.95e-25 SMART
EGF_like 961 997 6.03e1 SMART
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1047 1058 N/A INTRINSIC
low complexity region 1063 1078 N/A INTRINSIC
LamG 1081 1219 2.59e-30 SMART
4.1m 1305 1323 7.85e-7 SMART
low complexity region 1333 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138942
Meta Mutation Damage Score 0.238 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,838 S1624P probably benign Het
4930562C15Rik T A 16: 4,849,749 S335T unknown Het
4933421I07Rik T A 7: 42,448,031 H13L possibly damaging Het
6030468B19Rik A G 11: 117,806,008 T185A probably benign Het
Abcc1 T A 16: 14,410,771 V294E probably benign Het
Abhd16b A G 2: 181,493,460 T52A possibly damaging Het
Actl7a A T 4: 56,743,632 N53I probably benign Het
Ankmy1 T C 1: 92,886,723 E354G probably benign Het
Arap1 T C 7: 101,404,367 F1301S probably damaging Het
Arfgef1 A T 1: 10,153,733 W1447R probably damaging Het
Atoh7 ATGGCGCT AT 10: 63,100,408 probably benign Het
BC067074 A T 13: 113,368,336 N2000Y possibly damaging Het
Ccl24 T A 5: 135,572,957 T6S possibly damaging Het
Cep152 G T 2: 125,568,892 P1292Q possibly damaging Het
Cfap46 T C 7: 139,659,815 probably benign Het
Chd6 A T 2: 160,949,557 S2627T probably damaging Het
Chd8 A T 14: 52,231,506 S552T probably damaging Het
Ciita C A 16: 10,511,366 L502M probably damaging Het
Clic1 T C 17: 35,052,487 F31S probably damaging Het
Crispld1 T A 1: 17,749,607 D276E probably benign Het
Cspg4 A T 9: 56,885,808 N276Y probably damaging Het
Cwf19l2 A G 9: 3,410,035 M55V possibly damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dopey2 T C 16: 93,757,081 I301T probably damaging Het
Epg5 T C 18: 77,991,365 V1443A probably benign Het
Ephb4 T C 5: 137,365,702 V612A probably benign Het
Fcgbp T A 7: 28,094,937 C1189S probably damaging Het
Fgfr2 T G 7: 130,185,193 probably benign Het
Fmn2 A G 1: 174,609,895 E1144G probably damaging Het
Fmo3 T C 1: 162,968,838 Y55C probably damaging Het
Frmpd1 A G 4: 45,229,865 T11A probably damaging Het
Ghdc G T 11: 100,770,103 Q79K possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5591 T C 7: 38,522,256 T130A probably damaging Het
Heg1 T G 16: 33,719,772 D367E probably benign Het
Igkv13-84 C T 6: 68,939,910 P64S probably damaging Het
Il10rb T A 16: 91,414,657 S128T possibly damaging Het
Il15ra T A 2: 11,718,306 I47N probably damaging Het
Il33 C A 19: 29,958,911 S207* probably null Het
Itgb7 A G 15: 102,224,413 Y155H possibly damaging Het
Kdm5a A G 6: 120,369,099 probably benign Het
Kif11 G A 19: 37,417,949 V987I probably benign Het
Krtap19-2 G A 16: 88,873,874 probably benign Het
Krtap24-1 T A 16: 88,611,529 R236S probably damaging Het
L3mbtl2 A G 15: 81,682,612 I406V probably benign Het
Lrp2 A T 2: 69,459,715 H3593Q possibly damaging Het
Mavs G T 2: 131,240,365 W56C probably damaging Het
Mn1 C T 5: 111,419,660 P499S probably damaging Het
Ntn5 T A 7: 45,691,471 C178S probably damaging Het
Nufip2 A G 11: 77,686,328 H34R unknown Het
Olfr470 T A 7: 107,845,548 M62L possibly damaging Het
Olfr523 T A 7: 140,176,450 L110Q probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pitpna T A 11: 75,620,327 M242K possibly damaging Het
Pnpla6 T C 8: 3,522,838 V345A probably benign Het
Polk A G 13: 96,496,491 probably null Het
Polr3k A G 2: 181,864,547 Y30C probably damaging Het
Pramel6 A G 2: 87,509,597 H235R probably benign Het
Ptpra G A 2: 130,537,617 V364I probably damaging Het
Recql A G 6: 142,363,700 probably benign Het
Ring1 T C 17: 34,022,289 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 C A 16: 75,947,289 noncoding transcript Het
Scara5 A G 14: 65,730,749 H157R probably benign Het
Sdc3 C T 4: 130,819,065 P245L probably damaging Het
Slc18b1 T A 10: 23,820,869 M318K possibly damaging Het
Slc26a10 C T 10: 127,173,355 A638T possibly damaging Het
Slc35f2 T A 9: 53,809,729 W259R possibly damaging Het
Spata13 G A 14: 60,753,907 W366* probably null Het
Sptlc3 A G 2: 139,589,589 T344A probably benign Het
Tap1 T C 17: 34,193,891 V560A probably damaging Het
Tbc1d1 T C 5: 64,278,046 probably null Het
Tlr11 A G 14: 50,361,250 Y231C possibly damaging Het
Tmem245 A T 4: 56,936,468 S230T possibly damaging Het
Tnnt3 C T 7: 142,514,283 probably benign Het
Traf7 C G 17: 24,510,438 probably benign Het
Tshz2 A G 2: 169,962,681 probably benign Het
Tshz3 T C 7: 36,768,972 S129P probably damaging Het
Ttc6 A T 12: 57,729,451 N1727I probably damaging Het
Ttc7b A G 12: 100,403,362 S383P probably damaging Het
Tulp3 T A 6: 128,323,120 I448F probably damaging Het
Ube3b T C 5: 114,404,717 probably null Het
Vav1 G A 17: 57,296,552 V84I probably damaging Het
Vav3 A T 3: 109,508,794 K243I possibly damaging Het
Vmn1r25 T A 6: 57,979,026 I93F probably damaging Het
Vmn2r73 C T 7: 85,871,715 W348* probably null Het
Zdbf2 A G 1: 63,303,238 R259G possibly damaging Het
Other mutations in Cntnap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Cntnap1 APN 11 101185092 missense possibly damaging 0.63
IGL00715:Cntnap1 APN 11 101183205 splice site probably benign
IGL00792:Cntnap1 APN 11 101178966 missense probably benign 0.19
IGL01063:Cntnap1 APN 11 101181788 missense probably benign 0.00
IGL01141:Cntnap1 APN 11 101178807 splice site probably benign
IGL02184:Cntnap1 APN 11 101178365 missense probably damaging 0.98
IGL02272:Cntnap1 APN 11 101178316 missense probably damaging 0.99
IGL02281:Cntnap1 APN 11 101182254 missense possibly damaging 0.86
IGL02437:Cntnap1 APN 11 101186851 missense probably damaging 1.00
IGL02456:Cntnap1 APN 11 101178129 missense probably benign 0.31
IGL02966:Cntnap1 APN 11 101184749 missense probably damaging 1.00
IGL03126:Cntnap1 APN 11 101176301 missense probably benign 0.00
IGL03294:Cntnap1 APN 11 101181682 missense possibly damaging 0.94
Penny UTSW 11 101186764 missense probably damaging 0.99
FR4304:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4304:Cntnap1 UTSW 11 101189589 unclassified probably benign
FR4342:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4449:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189579 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189593 unclassified probably benign
FR4548:Cntnap1 UTSW 11 101189594 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189566 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189575 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189580 unclassified probably benign
FR4589:Cntnap1 UTSW 11 101189581 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189576 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189582 unclassified probably benign
FR4737:Cntnap1 UTSW 11 101189590 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189569 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189572 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189585 unclassified probably benign
FR4976:Cntnap1 UTSW 11 101189588 unclassified probably benign
R0329:Cntnap1 UTSW 11 101188309 missense probably damaging 1.00
R0556:Cntnap1 UTSW 11 101183996 missense probably benign
R0586:Cntnap1 UTSW 11 101187014 missense probably damaging 0.97
R0635:Cntnap1 UTSW 11 101183459 missense probably benign 0.05
R0789:Cntnap1 UTSW 11 101181384 splice site probably benign
R1016:Cntnap1 UTSW 11 101177507 missense probably damaging 0.99
R1085:Cntnap1 UTSW 11 101178836 missense probably benign 0.02
R1211:Cntnap1 UTSW 11 101184710 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1466:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1584:Cntnap1 UTSW 11 101180360 missense probably damaging 1.00
R1689:Cntnap1 UTSW 11 101188873 unclassified probably null
R1758:Cntnap1 UTSW 11 101184623 missense probably damaging 1.00
R1779:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R1964:Cntnap1 UTSW 11 101178024 nonsense probably null
R1966:Cntnap1 UTSW 11 101180386 missense possibly damaging 0.89
R2070:Cntnap1 UTSW 11 101182979 missense probably damaging 1.00
R2088:Cntnap1 UTSW 11 101182547 missense probably damaging 1.00
R2118:Cntnap1 UTSW 11 101188657 missense probably benign
R3795:Cntnap1 UTSW 11 101186764 missense probably damaging 0.99
R4375:Cntnap1 UTSW 11 101182253 missense probably damaging 1.00
R4832:Cntnap1 UTSW 11 101183019 missense probably damaging 1.00
R4965:Cntnap1 UTSW 11 101177425 missense possibly damaging 0.52
R4981:Cntnap1 UTSW 11 101176333 splice site probably null
R5008:Cntnap1 UTSW 11 101188741 nonsense probably null
R5399:Cntnap1 UTSW 11 101183316 missense probably benign
R5507:Cntnap1 UTSW 11 101183477 missense probably benign 0.42
R5560:Cntnap1 UTSW 11 101182435 missense probably damaging 1.00
R5589:Cntnap1 UTSW 11 101185118 missense probably benign
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6038:Cntnap1 UTSW 11 101184636 missense probably benign 0.12
R6242:Cntnap1 UTSW 11 101182538 missense probably damaging 1.00
R6306:Cntnap1 UTSW 11 101184615 missense probably damaging 1.00
R6392:Cntnap1 UTSW 11 101186646 missense probably damaging 1.00
R6803:Cntnap1 UTSW 11 101177234 missense possibly damaging 0.81
R6939:Cntnap1 UTSW 11 101186511 missense probably damaging 0.99
R6944:Cntnap1 UTSW 11 101182904 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTCCTGTGTGTAATCATGGAG -3'
(R):5'- ATCGTCGCCGTCAAAATACAG -3'

Sequencing Primer
(F):5'- CATGGGGATGGAGTAAACGCC -3'
(R):5'- GTCGCCGTCAAAATACAGGATGC -3'
Posted On2015-12-29