Incidental Mutation 'R3967:Itpkb'
ID368217
Institutional Source Beutler Lab
Gene Symbol Itpkb
Ensembl Gene ENSMUSG00000038855
Gene Nameinositol 1,4,5-trisphosphate 3-kinase B
Synonyms
MMRRC Submission 040838-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.784) question?
Stock #R3967 (G1)
Quality Score62
Status Validated
Chromosome1
Chromosomal Location180330485-180424802 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 180327798 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070181]
PDB Structure
Crystal Structure of the Catalytic and CaM-Binding domains of Inositol 1,4,5-Trisphosphate 3-Kinase B [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000050581
SMART Domains Protein: ENSMUSP00000050698
Gene: ENSMUSG00000055676

DomainStartEndE-ValueType
Gp_dh_N 2 154 5.53e-95 SMART
Pfam:Gp_dh_C 159 316 5.8e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070181
SMART Domains Protein: ENSMUSP00000069851
Gene: ENSMUSG00000038855

DomainStartEndE-ValueType
low complexity region 68 106 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 302 314 N/A INTRINSIC
low complexity region 595 618 N/A INTRINSIC
Pfam:IPK 722 933 3.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192714
Meta Mutation Damage Score 0.0696 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.2%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this protein regulates inositol phosphate metabolism by phosphorylation of second messenger inositol 1,4,5-trisphosphate to Ins(1,3,4,5)P4. The activity of this encoded protein is responsible for regulating the levels of a large number of inositol polyphosphates that are important in cellular signaling. Both calcium/calmodulin and protein phosphorylation mechanisms control its activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a block of thymocyte development at the double positive stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik G T 8: 121,539,980 Q56K possibly damaging Het
Adam18 C A 8: 24,629,710 V518L probably benign Het
Akap6 A T 12: 53,141,453 K1883N probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Ctnnd2 C A 15: 30,646,929 A257E possibly damaging Het
Depdc5 T A 5: 32,944,115 C322* probably null Het
Enpp7 T C 11: 118,991,001 I324T probably damaging Het
Gm14401 T C 2: 177,086,996 Y292H possibly damaging Het
Gm6871 A T 7: 41,546,724 H196Q probably damaging Het
Gm9964 T C 11: 79,296,376 T82A unknown Het
Gria2 T A 3: 80,710,777 Q317L possibly damaging Het
Grtp1 G A 8: 13,189,705 T134I probably benign Het
Kbtbd12 A G 6: 88,618,506 V114A probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ly75 T C 2: 60,327,873 I1023V possibly damaging Het
Myof C T 19: 37,901,263 V1287M probably damaging Het
Myof T G 19: 38,022,610 D60A possibly damaging Het
Narf A T 11: 121,238,421 E10D possibly damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Olfr512 A G 7: 108,713,853 M155V probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pidd1 A G 7: 141,439,082 F829L possibly damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pkn2 A G 3: 142,809,677 C658R probably damaging Het
Psd C T 19: 46,324,406 R175H probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Rnf39 C A 17: 36,943,143 T19K probably damaging Het
Slc16a3 C T 11: 120,955,425 T60M possibly damaging Het
Slc26a4 G T 12: 31,528,687 H656N probably damaging Het
Slc27a1 A G 8: 71,579,787 E184G probably damaging Het
Smc6 T C 12: 11,298,326 V742A probably benign Het
Thoc1 T A 18: 9,968,787 V186D probably damaging Het
Uhrf2 T C 19: 30,079,915 V491A probably damaging Het
Uri1 A G 7: 37,965,502 V253A possibly damaging Het
Vmn2r83 T A 10: 79,491,320 N587K probably benign Het
Vmn2r88 A T 14: 51,413,190 Y120F probably benign Het
Wwox G A 8: 114,488,933 A149T probably damaging Het
Zfp536 T C 7: 37,473,830 *282W probably null Het
Other mutations in Itpkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Itpkb APN 1 180332993 missense probably benign
IGL01733:Itpkb APN 1 180333169 missense possibly damaging 0.50
IGL01812:Itpkb APN 1 180420286 missense probably damaging 1.00
IGL01965:Itpkb APN 1 180332405 missense probably damaging 1.00
IGL02447:Itpkb APN 1 180421354 splice site probably benign
IGL03143:Itpkb APN 1 180333368 missense probably benign
IGL03228:Itpkb APN 1 180413999 missense probably damaging 1.00
lahar UTSW 1 180327225 unclassified probably benign
magma UTSW 1 180413975 missense probably damaging 1.00
Purpura UTSW 1 180334096 missense probably damaging 1.00
Pyroclastic UTSW 1 180334253 intron probably benign
volcano UTSW 1 180421315 missense probably damaging 1.00
IGL02991:Itpkb UTSW 1 180327714 unclassified probably benign
R0071:Itpkb UTSW 1 180332765 missense probably damaging 1.00
R0471:Itpkb UTSW 1 180418255 missense probably damaging 0.98
R0616:Itpkb UTSW 1 180421736 missense probably damaging 1.00
R1567:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2060:Itpkb UTSW 1 180421858 missense probably benign 0.00
R2474:Itpkb UTSW 1 180334151 missense probably damaging 1.00
R3022:Itpkb UTSW 1 180418323 missense probably damaging 0.96
R3792:Itpkb UTSW 1 180333173 missense possibly damaging 0.81
R3831:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3833:Itpkb UTSW 1 180333695 missense probably benign 0.00
R3968:Itpkb UTSW 1 180327798 unclassified probably benign
R4735:Itpkb UTSW 1 180418215 missense probably damaging 1.00
R4774:Itpkb UTSW 1 180418194 missense probably damaging 1.00
R4807:Itpkb UTSW 1 180334875 intron probably benign
R4895:Itpkb UTSW 1 180413895 missense probably damaging 1.00
R5514:Itpkb UTSW 1 180413909 missense probably damaging 1.00
R5593:Itpkb UTSW 1 180334096 missense probably damaging 1.00
R5633:Itpkb UTSW 1 180327225 unclassified probably benign
R5772:Itpkb UTSW 1 180334253 intron probably benign
R5898:Itpkb UTSW 1 180421315 missense probably damaging 1.00
R5903:Itpkb UTSW 1 180413975 missense probably damaging 1.00
R7060:Itpkb UTSW 1 180333130 missense probably damaging 1.00
X0066:Itpkb UTSW 1 180421780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCACGCCACAGCTTTCCAG -3'
(R):5'- TTGTCATCAACGGGAAGCC -3'

Sequencing Primer
(F):5'- CATCCACAGTCTTCTGGGTGG -3'
(R):5'- GGGAAGCCCATCACCATCTTC -3'
Posted On2016-01-06