Incidental Mutation 'R4091:4932414N04Rik'
ID368222
Institutional Source Beutler Lab
Gene Symbol 4932414N04Rik
Ensembl Gene ENSMUSG00000079324
Gene NameRIKEN cDNA 4932414N04 gene
Synonyms
MMRRC Submission 041626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4091 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location68656486-68748467 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 68745378 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 674 (S674P)
Ref Sequence ENSEMBL: ENSMUSP00000135792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055930] [ENSMUST00000128259]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055930
AA Change: S674P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000059809
Gene: ENSMUSG00000079324
AA Change: S674P

DomainStartEndE-ValueType
coiled coil region 154 241 N/A INTRINSIC
Pfam:DUF3496 265 361 8.5e-12 PFAM
internal_repeat_1 456 597 1.76e-26 PROSPERO
internal_repeat_1 601 737 1.76e-26 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000128259
AA Change: S674P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135792
Gene: ENSMUSG00000079324
AA Change: S674P

DomainStartEndE-ValueType
internal_repeat_1 5 39 6.02e-5 PROSPERO
internal_repeat_1 209 242 6.02e-5 PROSPERO
low complexity region 286 297 N/A INTRINSIC
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G A 3: 37,030,589 A3897T probably benign Het
A530099J19Rik T A 13: 19,729,465 noncoding transcript Het
Abca3 C T 17: 24,397,482 T966M probably damaging Het
Adam2 A T 14: 66,029,723 Y696N probably damaging Het
Aes G A 10: 81,565,584 G162D probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Arhgap25 G T 6: 87,463,035 S543R probably benign Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Carns1 C T 19: 4,171,683 R191Q probably damaging Het
Casp8ap2 C A 4: 32,643,611 P895T probably damaging Het
Col12a1 T A 9: 79,702,364 I287F probably damaging Het
Cystm1 A G 18: 36,366,547 N5S unknown Het
Dnah8 T C 17: 30,769,839 V3261A probably damaging Het
Dnajc11 A G 4: 151,978,093 probably benign Het
Dock4 T C 12: 40,844,267 S1847P probably damaging Het
Dync2h1 A G 9: 7,131,881 V1642A probably benign Het
Eftud2 T C 11: 102,839,416 probably null Het
Fam221b A G 4: 43,665,987 I208T probably benign Het
Gpr37l1 T C 1: 135,161,563 I255V probably benign Het
Grm7 G A 6: 110,914,340 S178N probably damaging Het
Hspa12b T A 2: 131,133,488 probably null Het
Kctd3 A T 1: 188,995,720 probably benign Het
Kynu G A 2: 43,679,872 V389M possibly damaging Het
Lcat A G 8: 105,939,906 L328P probably benign Het
Lrrn2 C T 1: 132,937,652 Q152* probably null Het
Maml1 G A 11: 50,291,829 P78L probably benign Het
Mef2b G A 8: 70,165,102 V37M probably damaging Het
Mindy2 A T 9: 70,634,060 M281K probably damaging Het
Mon2 C T 10: 123,038,510 R311H probably damaging Het
Mtr A T 13: 12,231,057 V394E probably damaging Het
Myh14 T A 7: 44,632,991 T745S possibly damaging Het
Nme9 T A 9: 99,464,527 D131E possibly damaging Het
Nphp4 C A 4: 152,547,018 Q792K probably damaging Het
Nrxn2 T A 19: 6,473,414 C479S probably damaging Het
Nsmf T C 2: 25,060,859 I406T probably damaging Het
Olfr1431 A T 19: 12,209,779 D71V probably damaging Het
Olfr517 G A 7: 108,868,443 A237V probably damaging Het
Olfr945 T A 9: 39,258,034 I213F possibly damaging Het
Pbrm1 A G 14: 31,036,003 T197A probably benign Het
Pla2r1 T A 2: 60,432,593 N1034I probably damaging Het
Rps6-ps2 A G 8: 88,806,691 noncoding transcript Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp1 A T 3: 79,644,761 D744E probably benign Het
Samd9l T C 6: 3,376,887 N125D probably benign Het
Serpina3a G A 12: 104,116,366 V133I probably benign Het
Slc22a30 C T 19: 8,404,545 V121M probably damaging Het
Smarcc1 T A 9: 110,164,829 D247E possibly damaging Het
Smg9 T A 7: 24,420,867 L422Q probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Utrn T A 10: 12,710,171 D954V probably benign Het
Vmn1r227 T A 17: 20,735,516 noncoding transcript Het
Vmn2r11 A C 5: 109,054,750 probably null Het
Vmn2r84 A T 10: 130,391,369 M200K probably damaging Het
Vmn2r88 T A 14: 51,415,426 Y469N probably damaging Het
Wdcp A G 12: 4,855,279 N600S probably null Het
Wdfy4 T G 14: 33,125,880 R838S possibly damaging Het
Other mutations in 4932414N04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:4932414N04Rik APN 2 68732875 missense probably benign 0.02
IGL01384:4932414N04Rik APN 2 68745405 missense possibly damaging 0.53
IGL02170:4932414N04Rik APN 2 68731123 missense probably benign 0.02
IGL02650:4932414N04Rik APN 2 68741537 missense probably benign 0.00
IGL02707:4932414N04Rik APN 2 68731130 missense possibly damaging 0.71
IGL02737:4932414N04Rik APN 2 68736560 missense possibly damaging 0.53
IGL03351:4932414N04Rik APN 2 68731083 missense probably benign
R0328:4932414N04Rik UTSW 2 68744280 missense possibly damaging 0.53
R0362:4932414N04Rik UTSW 2 68732917 missense probably benign 0.00
R0638:4932414N04Rik UTSW 2 68717228 missense probably benign 0.18
R1201:4932414N04Rik UTSW 2 68716282 missense possibly damaging 0.53
R1381:4932414N04Rik UTSW 2 68731086 missense probably benign 0.18
R1456:4932414N04Rik UTSW 2 68716214 missense possibly damaging 0.86
R2001:4932414N04Rik UTSW 2 68741456 missense probably benign
R2051:4932414N04Rik UTSW 2 68711048 missense possibly damaging 0.72
R2228:4932414N04Rik UTSW 2 68729591 missense probably benign 0.00
R2292:4932414N04Rik UTSW 2 68732139 missense probably benign 0.00
R2357:4932414N04Rik UTSW 2 68739500 missense possibly damaging 0.86
R2484:4932414N04Rik UTSW 2 68711475 missense possibly damaging 0.85
R3035:4932414N04Rik UTSW 2 68745418 missense probably benign 0.00
R3916:4932414N04Rik UTSW 2 68731985 missense possibly damaging 0.71
R3950:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3951:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R3952:4932414N04Rik UTSW 2 68664403 critical splice donor site probably null
R4118:4932414N04Rik UTSW 2 68736513 missense probably benign
R4153:4932414N04Rik UTSW 2 68668597 intron probably benign
R4210:4932414N04Rik UTSW 2 68659878 start gained probably benign
R4614:4932414N04Rik UTSW 2 68745460 missense probably benign 0.01
R4818:4932414N04Rik UTSW 2 68741466 missense probably benign
R5202:4932414N04Rik UTSW 2 68731964 missense probably benign
R5466:4932414N04Rik UTSW 2 68711389 missense probably benign 0.11
R5585:4932414N04Rik UTSW 2 68741426 missense probably benign 0.00
R5602:4932414N04Rik UTSW 2 68748368 makesense probably null
R5846:4932414N04Rik UTSW 2 68732033 missense unknown
R5902:4932414N04Rik UTSW 2 68708937 start codon destroyed probably null
R6002:4932414N04Rik UTSW 2 68662424 splice site probably null
R6029:4932414N04Rik UTSW 2 68694026 splice site probably null
R6093:4932414N04Rik UTSW 2 68659870 splice site probably benign
R6168:4932414N04Rik UTSW 2 68741483 missense possibly damaging 0.86
R6300:4932414N04Rik UTSW 2 68731109 missense possibly damaging 0.96
R6322:4932414N04Rik UTSW 2 68729499 missense probably benign 0.00
R6533:4932414N04Rik UTSW 2 68716318 nonsense probably null
R6547:4932414N04Rik UTSW 2 68659907 utr 5 prime probably benign
X0025:4932414N04Rik UTSW 2 68729016 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGCGACAGTCACTTCTTGC -3'
(R):5'- ACCCTGCATAGGTAGCTATCC -3'

Sequencing Primer
(F):5'- CCTTTGTAGTTTGGAATCCAGAC -3'
(R):5'- TGCATAGGTAGCTATCCACACTC -3'
Posted On2016-01-07