Incidental Mutation 'R3941:Mprip'
ID368253
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Namemyosin phosphatase Rho interacting protein
Synonymsp116Rip, Rhoip3, RIP3, p116 Rho interacting protein
MMRRC Submission 040923-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R3941 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59661305-59780860 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 59731502 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
Predicted Effect probably benign
Transcript: ENSMUST00000066330
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072031
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108751
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116371
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132620
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133861
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153431
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610203C20Rik T C 9: 41,590,274 L143P probably damaging Het
Abcc1 A T 16: 14,396,399 T193S probably benign Het
Arhgap11a A T 2: 113,836,897 L435Q probably damaging Het
Bin1 T C 18: 32,406,158 V48A probably damaging Het
Brinp3 C A 1: 146,751,861 D277E probably damaging Het
Btn1a1 T G 13: 23,459,264 R338S probably benign Het
Cacnb4 C A 2: 52,469,489 R169L probably damaging Het
Ccdc80 A G 16: 45,096,092 T404A probably benign Het
Cd2ap G C 17: 42,808,799 H488D probably damaging Het
Cdon A G 9: 35,464,171 T498A probably benign Het
Cngb3 A G 4: 19,396,786 N380D probably benign Het
Col6a5 G A 9: 105,939,834 S426F unknown Het
Cr2 A T 1: 195,165,814 H345Q probably damaging Het
Cttnbp2 T A 6: 18,427,453 K743M probably benign Het
Depdc1b T C 13: 108,368,836 S245P probably damaging Het
Dync2h1 G A 9: 7,124,825 H2016Y probably benign Het
Eif2s3y G T Y: 1,012,079 R98L probably benign Het
Eml6 C T 11: 29,803,167 G915S probably damaging Het
Fcgr1 A G 3: 96,286,033 L216P probably benign Het
Fpr-rs3 T C 17: 20,624,849 N10S probably benign Het
Frem3 T C 8: 80,615,020 I1314T possibly damaging Het
Gabrr3 A G 16: 59,433,501 N194D probably damaging Het
Hey1 A G 3: 8,664,578 L273P probably damaging Het
Irf6 A G 1: 193,168,549 K365E probably benign Het
Kit A G 5: 75,609,318 D130G probably benign Het
Lrp1 G A 10: 127,553,396 A3217V probably damaging Het
Mei4 C T 9: 81,927,283 R140C probably benign Het
Mpo A T 11: 87,797,349 K278M probably benign Het
Mug2 G C 6: 122,063,563 G691R probably benign Het
Neto2 G A 8: 85,674,118 T16I probably damaging Het
Nipal4 C T 11: 46,150,646 V241M probably damaging Het
Nlrp2 A T 7: 5,327,552 L615* probably null Het
Pcdh1 A G 18: 38,199,458 V164A probably benign Het
Phc2 T C 4: 128,747,244 probably null Het
Plekhg3 A G 12: 76,573,359 E623G probably damaging Het
Psors1c2 G T 17: 35,533,928 G29* probably null Het
Slc25a54 A T 3: 109,112,163 D361V probably damaging Het
Slc39a12 A T 2: 14,396,181 H123L possibly damaging Het
Sorl1 T C 9: 41,989,468 probably null Het
Strn A T 17: 78,657,940 I641N probably damaging Het
Tapbp A G 17: 33,920,483 E151G possibly damaging Het
Ticrr T C 7: 79,693,697 probably benign Het
Tnfrsf21 G A 17: 43,038,010 C171Y probably damaging Het
Ttyh1 T A 7: 4,129,318 L155H probably damaging Het
Utrn T A 10: 12,711,585 probably null Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Vmn1r73 T C 7: 11,756,755 Y167H probably damaging Het
Washc1 T C 17: 66,118,128 S376P probably damaging Het
Wnt10a T A 1: 74,803,497 probably null Het
Xrcc4 A G 13: 90,071,633 V16A probably benign Het
Zeb1 T C 18: 5,767,799 V770A probably benign Het
Zfp410 A G 12: 84,338,753 N90S probably damaging Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59748591 missense probably benign 0.07
IGL00563:Mprip APN 11 59752617 missense probably damaging 1.00
IGL00905:Mprip APN 11 59772168 missense possibly damaging 0.79
IGL00928:Mprip APN 11 59744752 missense probably damaging 1.00
IGL01161:Mprip APN 11 59731573 missense possibly damaging 0.93
IGL01991:Mprip APN 11 59755012 missense probably damaging 0.99
IGL02491:Mprip APN 11 59770031 missense probably benign 0.13
IGL03030:Mprip APN 11 59741115 splice site probably null
IGL03056:Mprip APN 11 59771692 missense probably damaging 1.00
IGL03293:Mprip APN 11 59696163 missense probably damaging 1.00
R0049:Mprip UTSW 11 59766745 missense probably damaging 0.99
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0097:Mprip UTSW 11 59758491 missense possibly damaging 0.90
R0147:Mprip UTSW 11 59737073 missense possibly damaging 0.68
R0319:Mprip UTSW 11 59697038 splice site probably benign
R0471:Mprip UTSW 11 59759735 missense probably damaging 1.00
R0539:Mprip UTSW 11 59741117 splice site probably benign
R0627:Mprip UTSW 11 59769972 missense probably damaging 1.00
R0864:Mprip UTSW 11 59758761 missense probably benign
R1218:Mprip UTSW 11 59743814 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1469:Mprip UTSW 11 59759190 missense probably damaging 1.00
R1695:Mprip UTSW 11 59752531 missense probably damaging 0.99
R1698:Mprip UTSW 11 59760258 missense possibly damaging 0.75
R1802:Mprip UTSW 11 59755041 missense probably damaging 1.00
R1837:Mprip UTSW 11 59766745 missense probably damaging 0.99
R1862:Mprip UTSW 11 59758221 missense possibly damaging 0.90
R2094:Mprip UTSW 11 59749508 splice site probably benign
R2107:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2108:Mprip UTSW 11 59769891 missense probably damaging 1.00
R2510:Mprip UTSW 11 59749508 splice site probably benign
R3003:Mprip UTSW 11 59727555 missense possibly damaging 0.95
R3115:Mprip UTSW 11 59765403 splice site probably null
R4347:Mprip UTSW 11 59759453 missense possibly damaging 0.86
R4603:Mprip UTSW 11 59731573 missense probably damaging 1.00
R4807:Mprip UTSW 11 59758020 missense probably benign 0.00
R5011:Mprip UTSW 11 59759895 missense possibly damaging 0.75
R5338:Mprip UTSW 11 59760573 missense probably damaging 1.00
R5549:Mprip UTSW 11 59760818 missense probably benign 0.00
R5569:Mprip UTSW 11 59760963 missense probably damaging 1.00
R5604:Mprip UTSW 11 59758467 missense probably benign
R5615:Mprip UTSW 11 59758487 missense probably benign 0.08
R5846:Mprip UTSW 11 59758554 missense probably damaging 1.00
R5970:Mprip UTSW 11 59757721 missense probably damaging 0.96
R6054:Mprip UTSW 11 59758425 missense probably benign
R6452:Mprip UTSW 11 59752783 missense probably damaging 1.00
R6457:Mprip UTSW 11 59758989 missense possibly damaging 0.69
R6544:Mprip UTSW 11 59757726 missense probably benign 0.15
R6750:Mprip UTSW 11 59696131 missense probably damaging 1.00
R6843:Mprip UTSW 11 59759728 missense possibly damaging 0.54
R6851:Mprip UTSW 11 59759015 missense probably damaging 0.99
R6867:Mprip UTSW 11 59749630 critical splice donor site probably null
R7002:Mprip UTSW 11 59761190 missense probably benign 0.22
R7023:Mprip UTSW 11 59737389 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTACTGCACTCTGATCTG -3'
(R):5'- TATGGCTCCTAGGGTACAGG -3'

Sequencing Primer
(F):5'- TGCACTCTGATCTGGAGTAACAC -3'
(R):5'- TGCAAAGTGTGACCACCTCAG -3'
Posted On2016-01-11