Incidental Mutation 'R4079:Ung'
ID368272
Institutional Source Beutler Lab
Gene Symbol Ung
Ensembl Gene ENSMUSG00000029591
Gene Nameuracil DNA glycosylase
SynonymsUNG1
MMRRC Submission 040976-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.734) question?
Stock #R4079 (G1)
Quality Score69
Status Validated
Chromosome5
Chromosomal Location114130386-114139323 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 114130623 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031587] [ENSMUST00000053657] [ENSMUST00000102584] [ENSMUST00000112275] [ENSMUST00000112279] [ENSMUST00000137402] [ENSMUST00000143455] [ENSMUST00000149418]
Predicted Effect probably benign
Transcript: ENSMUST00000031587
AA Change: V41L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031587
Gene: ENSMUSG00000029591
AA Change: V41L

DomainStartEndE-ValueType
low complexity region 72 81 N/A INTRINSIC
UDG 132 293 5.86e-35 SMART
UreE_C 132 293 5.86e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000053657
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102584
SMART Domains Protein: ENSMUSP00000099644
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
UDG 121 282 5.86e-35 SMART
UreE_C 121 282 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112275
SMART Domains Protein: ENSMUSP00000107894
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
UDG 25 186 5.86e-35 SMART
UreE_C 25 186 5.86e-35 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112279
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137402
SMART Domains Protein: ENSMUSP00000114140
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
UDG 35 184 2.05e-25 SMART
UreE_C 35 184 2.05e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143455
SMART Domains Protein: ENSMUSP00000142484
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
PDB:2SSP|E 76 127 3e-27 PDB
SCOP:d3euga_ 79 127 1e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000149418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200479
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (73/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mutants incorporate an elevated level of uracil into DNA of dividing cells. In hypermutation at immunoglobulin genes, mutations at C/G pairs are shifted toward transitions, and class-switch recombination is reduced. Homozygous null mutants display increased ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago3 C G 4: 126,353,680 probably null Het
Ankfy1 C A 11: 72,690,009 probably benign Het
Ap4b1 T A 3: 103,813,378 N121K probably damaging Het
Arhgef12 T C 9: 42,975,292 M1131V probably damaging Het
Arl5c A T 11: 97,993,501 I88N probably damaging Het
Armc9 A T 1: 86,213,129 probably benign Het
Bnc1 T C 7: 81,973,760 E573G probably damaging Het
Btaf1 A G 19: 36,986,479 T817A probably benign Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Cadm3 A G 1: 173,341,669 V293A probably benign Het
Cadps C T 14: 12,457,702 A1060T probably benign Het
Cbfa2t3 A G 8: 122,647,695 probably null Het
Ccdc18 C T 5: 108,158,528 Q270* probably null Het
Cdc45 A T 16: 18,811,360 V19D probably damaging Het
Cfap57 C A 4: 118,598,997 S500I probably benign Het
Cnga3 A T 1: 37,241,865 Q47L possibly damaging Het
Corin T C 5: 72,503,883 D89G probably benign Het
Cox16 A T 12: 81,474,335 probably benign Het
Cyp2a4 A G 7: 26,307,366 N50S probably benign Het
Diaph1 T A 18: 37,853,583 E1116D possibly damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Enpp1 A G 10: 24,669,007 probably null Het
F13b T A 1: 139,501,770 F9I unknown Het
Fcer1a C T 1: 173,225,353 C36Y probably damaging Het
Fcho2 A G 13: 98,755,612 V318A probably damaging Het
Fzd9 A G 5: 135,249,636 V465A probably benign Het
Gm10354 A T 5: 14,977,649 L71Q probably damaging Het
Hbs1l T C 10: 21,352,602 V493A probably damaging Het
Hgs T A 11: 120,483,048 S723T probably benign Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Kpna7 A G 5: 145,005,927 I83T possibly damaging Het
Llgl1 C A 11: 60,710,284 probably null Het
Lrig3 A C 10: 126,009,787 E695A probably damaging Het
Lrpap1 A G 5: 35,096,037 I261T possibly damaging Het
Mfn1 T G 3: 32,542,849 L152W probably damaging Het
Mog A G 17: 37,012,410 F212S probably damaging Het
Mpeg1 A G 19: 12,462,270 N364S probably damaging Het
Mtmr3 C T 11: 4,491,057 R531Q probably damaging Het
Mx2 A G 16: 97,556,036 N443S probably damaging Het
Nfatc3 T C 8: 106,079,491 Y323H probably damaging Het
Nup188 G A 2: 30,309,878 D305N probably damaging Het
Obscn A G 11: 59,038,363 V6145A probably benign Het
Olfr1037 A G 2: 86,085,312 V155A possibly damaging Het
Olfr686 A T 7: 105,204,021 H107Q probably damaging Het
Patl1 C T 19: 11,931,630 A467V probably damaging Het
Pdss2 A T 10: 43,402,522 M342L probably benign Het
Phax A G 18: 56,575,979 N183S possibly damaging Het
Pnck A T X: 73,658,155 V93E probably damaging Het
Prol1 A G 5: 88,328,216 N155S unknown Het
Ptprk G A 10: 28,263,512 V78I probably benign Het
Ptpru A T 4: 131,798,710 probably null Het
Ptprv A G 1: 135,110,430 noncoding transcript Het
Ranbp3l A G 15: 9,060,757 N233S probably damaging Het
Rapgefl1 A G 11: 98,849,977 T552A probably benign Het
Rasgrp1 A G 2: 117,285,029 S693P probably benign Het
Scyl2 A T 10: 89,640,596 M889K probably benign Het
Serpina3a C T 12: 104,119,675 Q320* probably null Het
Slc12a1 A T 2: 125,200,623 N733I possibly damaging Het
Snap47 C T 11: 59,428,551 V254I probably benign Het
St6galnac2 A T 11: 116,681,898 L244Q possibly damaging Het
Syce1 C A 7: 140,779,896 L83F probably damaging Het
Tjp2 A T 19: 24,108,818 V780E possibly damaging Het
Tns1 G A 1: 73,995,308 R192C probably damaging Het
Trav6-3 T C 14: 53,430,080 L3P possibly damaging Het
Usp32 T A 11: 85,039,229 Y574F probably damaging Het
Other mutations in Ung
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ung APN 5 114137308 missense possibly damaging 0.50
IGL01995:Ung APN 5 114136386 missense probably benign 0.30
IGL02084:Ung APN 5 114130576 missense probably benign 0.00
R1219:Ung UTSW 5 114132167 unclassified probably benign
R1617:Ung UTSW 5 114131354 missense probably benign 0.14
R2513:Ung UTSW 5 114137192 missense probably benign 0.11
R4078:Ung UTSW 5 114130623 unclassified probably null
R6210:Ung UTSW 5 114131377 missense probably benign 0.15
R6258:Ung UTSW 5 114137300 missense probably benign 0.12
R6954:Ung UTSW 5 114131337 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GCTTTAGAGCTAGGACAGGTAG -3'
(R):5'- TGCACACTGATTGGCTCTGC -3'

Sequencing Primer
(F):5'- CTTTAGAGCTAGGACAGGTAGGTAGG -3'
(R):5'- ATTGGCTCTGCGGCGAC -3'
Posted On2016-01-15