Incidental Mutation 'R4093:Kcnt1'
ID368278
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Namepotassium channel, subfamily T, member 1
SynonymsC030030G16Rik, Slack, slo2
MMRRC Submission 041627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R4093 (G1)
Quality Score43
Status Validated
Chromosome2
Chromosomal Location25863734-25918273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25877915 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 12 (E12V)
Ref Sequence ENSEMBL: ENSMUSP00000143106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
Predicted Effect probably damaging
Transcript: ENSMUST00000037580
AA Change: E12V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740
AA Change: E12V

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114170
SMART Domains Protein: ENSMUSP00000109807
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 84 103 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Pfam:Ion_trans_2 239 317 4.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114172
AA Change: E12V

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740
AA Change: E12V

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114176
AA Change: E12V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740
AA Change: E12V

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150788
Predicted Effect probably benign
Transcript: ENSMUST00000171268
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197917
AA Change: E12V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740
AA Change: E12V

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198204
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200434
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,043,996 M2173V probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Angpt1 T C 15: 42,523,545 T138A probably damaging Het
Atp2c2 G A 8: 119,749,871 probably null Het
C330027C09Rik T C 16: 49,000,976 probably benign Het
Cadm2 A G 16: 66,784,788 V210A possibly damaging Het
Cfap70 A T 14: 20,409,113 D671E probably damaging Het
Chd2 C T 7: 73,501,016 E322K possibly damaging Het
Chrnd C T 1: 87,191,007 Q29* probably null Het
Cym A G 3: 107,214,266 S237P probably benign Het
D030068K23Rik A G 8: 109,251,459 noncoding transcript Het
Gsdma2 T A 11: 98,650,851 S135T probably benign Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hoxb3 C A 11: 96,346,100 H335N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Ighv1-19 G A 12: 114,708,730 T90I probably damaging Het
Kansl3 C A 1: 36,344,954 S729I probably damaging Het
Kcnab1 T C 3: 65,299,614 I137T possibly damaging Het
Klk15 A T 7: 43,938,780 S171C possibly damaging Het
Lcn2 A T 2: 32,387,716 M1K probably null Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp8 T A 4: 107,843,271 C135* probably null Het
Lrrc31 C A 3: 30,695,522 S54I probably damaging Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Med27 G A 2: 29,377,908 probably benign Het
Mical1 T C 10: 41,486,937 probably benign Het
Myt1 A T 2: 181,811,398 M799L probably damaging Het
Nlrc4 T C 17: 74,445,958 M477V probably benign Het
Npy4r T C 14: 34,147,141 I63M probably benign Het
Olfr224 A T 11: 58,566,829 I172N probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr672 C T 7: 104,996,635 G90S probably benign Het
Olfr904 T A 9: 38,464,083 L14Q probably null Het
Piezo1 A C 8: 122,501,160 probably null Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Proser1 T C 3: 53,479,712 probably null Het
Psme2 A T 14: 55,588,277 N143K probably benign Het
Pygo2 C A 3: 89,433,264 P323Q probably damaging Het
Rab11b T C 17: 33,749,789 T77A possibly damaging Het
Recql5 A G 11: 115,904,888 S190P probably benign Het
Serpina12 A G 12: 104,037,924 F150L probably damaging Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a2 C T 17: 12,612,394 T357M probably damaging Het
Spag6l A C 16: 16,829,024 N39K probably benign Het
Srl A G 16: 4,497,452 S109P possibly damaging Het
Tagap A T 17: 7,929,423 H152L probably damaging Het
Tbx3 T A 5: 119,680,748 S463T probably benign Het
Tcaf2 A G 6: 42,642,838 L85P probably damaging Het
Tenm4 A T 7: 96,895,772 S2332C probably damaging Het
Trim60 A T 8: 65,001,378 M73K probably benign Het
Trpc1 T C 9: 95,706,865 T769A probably benign Het
Tubgcp4 T A 2: 121,195,477 L601Q probably benign Het
Unc5d T C 8: 28,844,837 Y154C possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Vmn1r57 G T 7: 5,220,857 S127I possibly damaging Het
Vmn1r62 T A 7: 5,675,944 M208K probably damaging Het
Vmn2r110 T C 17: 20,583,380 D311G possibly damaging Het
Vmn2r48 C A 7: 9,942,258 S432I probably benign Het
Vmn2r48 T A 7: 9,942,259 S432C probably damaging Het
Vmn2r71 T C 7: 85,621,234 V536A probably benign Het
Vstm2a A G 11: 16,259,884 T37A probably damaging Het
Wfs1 T C 5: 36,967,465 H694R probably damaging Het
Zdbf2 T C 1: 63,309,781 S2440P possibly damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25892407 missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25916005 missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25898754 missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25900967 missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25888125 missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25912719 critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25908152 missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25900482 critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25901865 missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25900880 splice site probably benign
IGL02683:Kcnt1 APN 2 25900925 missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25909203 critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25894468 splice site probably benign
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25892362 missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25898264 splice site probably benign
R0294:Kcnt1 UTSW 2 25888110 missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25907628 missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25892496 missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25891243 splice site probably benign
R1364:Kcnt1 UTSW 2 25908094 missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25900385 missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25900469 missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25892360 missense probably benign
R2079:Kcnt1 UTSW 2 25900248 missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25891183 splice site probably benign
R2295:Kcnt1 UTSW 2 25900921 missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25894359 missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25900892 missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25915868 critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25893214 missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25916048 missense possibly damaging 0.77
R4361:Kcnt1 UTSW 2 25878032 missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25907626 missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25908100 missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25901346 missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25909322 intron probably benign
R5223:Kcnt1 UTSW 2 25903422 missense probably benign
R5243:Kcnt1 UTSW 2 25908074 missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25909277 missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25901909 nonsense probably null
R5888:Kcnt1 UTSW 2 25908110 missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25894524 intron probably benign
R5906:Kcnt1 UTSW 2 25898401 missense probably damaging 1.00
R5927:Kcnt1 UTSW 2 25909376 intron probably benign
R6160:Kcnt1 UTSW 2 25892383 missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25903385 missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25893180 missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25892510 missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25903597 splice site probably null
R6336:Kcnt1 UTSW 2 25888755 unclassified probably null
R6395:Kcnt1 UTSW 2 25909239 missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25911051 missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25877828 intron probably benign
R7236:Kcnt1 UTSW 2 25909939 splice site probably null
R7308:Kcnt1 UTSW 2 25900463 missense possibly damaging 0.74
R7346:Kcnt1 UTSW 2 25863843 unclassified probably benign
R7419:Kcnt1 UTSW 2 25915999 missense probably benign 0.11
R7461:Kcnt1 UTSW 2 25901346 missense probably benign 0.01
R7470:Kcnt1 UTSW 2 25909833 missense probably damaging 0.96
R7566:Kcnt1 UTSW 2 25916036 missense not run
Predicted Primers PCR Primer
(F):5'- GACAGCTGTACACTGGAACTGC -3'
(R):5'- GCCAGTGCTAAACAAAATGCG -3'

Sequencing Primer
(F):5'- GTACACTGGAACTGCGTCCTC -3'
(R):5'- GTGCTAAACAAAATGCGAACGAC -3'
Posted On2016-01-15