Incidental Mutation 'R0413:Sema5a'
ID36829
Institutional Source Beutler Lab
Gene Symbol Sema5a
Ensembl Gene ENSMUSG00000022231
Gene Namesema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
SynonymssemF, 9130201M22Rik, Semaf, M-Sema D
MMRRC Submission 038615-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0413 (G1)
Quality Score224
Status Validated
Chromosome15
Chromosomal Location32244810-32696341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32669444 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 705 (K705E)
Ref Sequence ENSEMBL: ENSMUSP00000069024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067458]
Predicted Effect probably damaging
Transcript: ENSMUST00000067458
AA Change: K705E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069024
Gene: ENSMUSG00000022231
AA Change: K705E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Sema 58 468 2.18e-173 SMART
PSI 486 533 1.78e-9 SMART
TSP1 543 597 2.23e-1 SMART
TSP1 598 651 2.05e-15 SMART
TSP1 656 702 6.94e-13 SMART
low complexity region 707 715 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
TSP1 787 839 4.17e-16 SMART
TSP1 844 896 9.08e-17 SMART
TSP1 899 946 3.19e-3 SMART
low complexity region 949 960 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227976
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (99/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the semaphorin gene family that encodes membrane proteins containing a semaphorin domain and several thrombospondin type-1 repeats. Members of this family are involved in axonal guidance during neural development. This gene has been implicated as an autism susceptibility gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for one null mutation die during organogenesis and display defects in branching of cranial vessels. Mice homozygous for another null mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,328,011 probably benign Het
Adh1 C T 3: 138,280,432 T60I probably benign Het
Agtpbp1 T A 13: 59,514,152 I282F probably benign Het
AI464131 G T 4: 41,498,585 H348Q probably benign Het
Arih2 G T 9: 108,616,717 Q166K probably damaging Het
BC027072 T G 17: 71,752,217 D155A probably benign Het
Cacna1s A G 1: 136,098,209 T1031A probably benign Het
Ccdc102a C A 8: 94,903,286 E542D probably benign Het
Cdk1 T C 10: 69,345,099 I94V probably benign Het
Cep290 C T 10: 100,523,314 Q969* probably null Het
Cilp2 A G 8: 69,882,993 S452P probably benign Het
Col12a1 T C 9: 79,699,360 T594A probably damaging Het
Cpox A G 16: 58,670,869 T148A possibly damaging Het
Csf3r A G 4: 126,039,667 probably benign Het
Csmd1 A T 8: 16,710,514 C202S probably damaging Het
Dlgap4 T C 2: 156,762,826 S261P probably damaging Het
Dnah9 T A 11: 66,108,135 Y1029F probably damaging Het
Dok5 T C 2: 170,829,960 probably benign Het
Dusp11 A T 6: 85,952,370 probably benign Het
Edar T C 10: 58,629,440 N34D probably benign Het
Efcab7 C T 4: 99,909,746 T56I probably damaging Het
Entpd1 G A 19: 40,711,285 V47I probably benign Het
Ephx4 A G 5: 107,403,735 N62S probably benign Het
Etaa1 A T 11: 17,946,350 L589* probably null Het
Fam135b T A 15: 71,463,821 N508I probably benign Het
Fam193a T C 5: 34,466,208 V27A possibly damaging Het
Fmnl1 A G 11: 103,194,063 probably benign Het
Fstl1 A C 16: 37,821,154 probably null Het
Gbp4 G A 5: 105,121,106 R394C possibly damaging Het
Gemin4 T C 11: 76,211,322 Y871C probably benign Het
Gm7247 T C 14: 51,523,472 V166A probably benign Het
Gpcpd1 A T 2: 132,564,623 probably benign Het
Gpnmb A G 6: 49,042,803 D36G probably benign Het
Ido2 C T 8: 24,558,143 probably null Het
Igfn1 G A 1: 135,967,596 T1744I probably benign Het
Inf2 T G 12: 112,601,676 F221V probably damaging Het
Itga10 T A 3: 96,649,059 I170N probably damaging Het
Lrp6 A T 6: 134,507,624 D345E probably damaging Het
Macf1 A T 4: 123,472,269 S2900T probably benign Het
Med13 C A 11: 86,299,207 probably benign Het
Morc3 T C 16: 93,870,474 V507A probably damaging Het
Myadm AC ACC 7: 3,296,760 probably null Het
Myl6 C T 10: 128,492,222 probably benign Het
Mylk T C 16: 34,921,944 V942A probably benign Het
Ncdn G T 4: 126,750,534 T165K possibly damaging Het
Ncf1 T C 5: 134,222,802 probably benign Het
Neb T C 2: 52,290,739 probably benign Het
Nid1 T A 13: 13,482,096 I604N probably benign Het
Nsrp1 T C 11: 77,046,171 R400G probably benign Het
Nup43 T G 10: 7,671,027 I137S probably benign Het
Nynrin A G 14: 55,872,191 N1585S possibly damaging Het
Obscn T A 11: 59,002,997 Y6748F probably benign Het
Olfr1058 G A 2: 86,385,714 R235C probably benign Het
Olfr1211 A G 2: 88,929,562 V251A probably benign Het
Olfr1389 T C 11: 49,431,385 V303A possibly damaging Het
Olfr60 A T 7: 140,345,195 S265T possibly damaging Het
Olfr623 A T 7: 103,660,750 F167I possibly damaging Het
Olfr67 A G 7: 103,788,155 Y41H probably damaging Het
Olfr944 A G 9: 39,218,270 I304M probably benign Het
Olfr992 T C 2: 85,399,675 N286S probably damaging Het
Omg A G 11: 79,502,835 S66P possibly damaging Het
Ormdl1 C T 1: 53,308,819 probably benign Het
Ovch2 T A 7: 107,782,036 I552L probably benign Het
Pcsk9 G T 4: 106,454,341 T231N probably damaging Het
Pgpep1 T C 8: 70,657,450 N22S probably damaging Het
Plb1 T C 5: 32,355,362 F1355L probably damaging Het
Plcg1 G T 2: 160,761,429 L1173F probably damaging Het
Plch2 A T 4: 155,006,916 probably null Het
Ppp1r3g T A 13: 35,969,348 F250L probably damaging Het
Prkcg A G 7: 3,319,579 I381V probably benign Het
Pum2 C T 12: 8,713,464 A207V probably benign Het
Rabac1 T C 7: 24,970,182 E166G probably damaging Het
Rad21l G A 2: 151,651,931 S450L probably benign Het
Rangap1 ACACTCA ACA 15: 81,716,675 probably null Het
Reg3b G T 6: 78,371,841 C40F probably damaging Het
Rfx2 A G 17: 56,784,418 probably benign Het
Rrp15 G A 1: 186,749,149 probably benign Het
Schip1 G T 3: 68,494,613 G36C probably damaging Het
Sec61a2 A T 2: 5,876,354 probably benign Het
Setx A G 2: 29,139,278 Y186C probably damaging Het
Slc22a23 T C 13: 34,183,132 E631G probably damaging Het
Slc5a5 T C 8: 70,891,675 T134A possibly damaging Het
Stx7 T C 10: 24,181,594 S173P probably damaging Het
Sybu T C 15: 44,673,272 T353A probably damaging Het
Syde2 T A 3: 146,007,132 N1008K probably damaging Het
Tiam1 T C 16: 89,809,365 probably benign Het
Timm10b G A 7: 105,678,330 E61K probably benign Het
Tm2d1 A G 4: 98,365,573 I121T probably damaging Het
Trim75 T C 8: 64,983,240 E186G probably benign Het
Tti1 T C 2: 157,995,476 K895E probably benign Het
Vmn1r43 A G 6: 89,869,848 S219P probably damaging Het
Vmn2r73 A T 7: 85,871,879 S294T possibly damaging Het
Vmn2r94 A T 17: 18,243,818 F737I probably damaging Het
Vsx2 A T 12: 84,570,003 T21S probably benign Het
Wrb T G 16: 96,153,017 S105R probably benign Het
Zfp462 G T 4: 55,010,534 R833S probably damaging Het
Zfpl1 G A 19: 6,082,452 P143L probably damaging Het
Other mutations in Sema5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Sema5a APN 15 32618880 missense probably benign 0.06
IGL01148:Sema5a APN 15 32681495 missense probably benign 0.00
IGL01285:Sema5a APN 15 32574997 missense possibly damaging 0.66
IGL01647:Sema5a APN 15 32417441 missense possibly damaging 0.82
IGL01845:Sema5a APN 15 32474368 splice site probably benign
IGL01970:Sema5a APN 15 32686646 missense probably benign 0.02
IGL01986:Sema5a APN 15 32682360 splice site probably benign
IGL02053:Sema5a APN 15 32550267 missense probably benign 0.00
IGL02234:Sema5a APN 15 32679172 missense probably damaging 1.00
IGL02325:Sema5a APN 15 32686831 missense possibly damaging 0.63
IGL02370:Sema5a APN 15 32682299 splice site probably benign
IGL02427:Sema5a APN 15 32673544 splice site probably benign
IGL02621:Sema5a APN 15 32538656 splice site probably benign
IGL02656:Sema5a APN 15 32631285 missense possibly damaging 0.95
IGL03091:Sema5a APN 15 32538734 splice site probably benign
IGL03107:Sema5a APN 15 32669408 missense probably damaging 0.98
IGL03114:Sema5a APN 15 32673427 missense probably damaging 0.99
IGL03222:Sema5a APN 15 32628158 missense probably benign 0.32
PIT4305001:Sema5a UTSW 15 32628199 missense probably benign
R0190:Sema5a UTSW 15 32562774 missense possibly damaging 0.93
R0409:Sema5a UTSW 15 32681609 missense probably damaging 1.00
R0504:Sema5a UTSW 15 32574803 splice site probably benign
R1235:Sema5a UTSW 15 32609226 missense probably benign 0.04
R1484:Sema5a UTSW 15 32460285 missense probably damaging 1.00
R1550:Sema5a UTSW 15 32618849 missense probably benign 0.00
R1557:Sema5a UTSW 15 32460272 missense probably benign 0.04
R1670:Sema5a UTSW 15 32548799 missense probably damaging 1.00
R1688:Sema5a UTSW 15 32669424 missense probably benign 0.01
R1760:Sema5a UTSW 15 32641106 missense probably damaging 0.99
R1960:Sema5a UTSW 15 32562731 missense possibly damaging 0.66
R1967:Sema5a UTSW 15 32681619 missense probably damaging 0.99
R2062:Sema5a UTSW 15 32609217 splice site probably benign
R2082:Sema5a UTSW 15 32618856 missense probably benign 0.04
R2218:Sema5a UTSW 15 32631309 missense probably damaging 0.99
R2267:Sema5a UTSW 15 32574919 missense probably benign 0.03
R2299:Sema5a UTSW 15 32562776 missense possibly damaging 0.95
R2438:Sema5a UTSW 15 32550253 missense possibly damaging 0.63
R2698:Sema5a UTSW 15 32673400 missense probably damaging 1.00
R3950:Sema5a UTSW 15 32689338 missense probably damaging 1.00
R4197:Sema5a UTSW 15 32618918 missense probably benign
R4496:Sema5a UTSW 15 32640987 missense probably damaging 1.00
R4840:Sema5a UTSW 15 32550254 missense possibly damaging 0.63
R4842:Sema5a UTSW 15 32609417 missense probably benign
R4867:Sema5a UTSW 15 32550290 missense possibly damaging 0.60
R4934:Sema5a UTSW 15 32679164 missense probably damaging 1.00
R4977:Sema5a UTSW 15 32679186 missense probably damaging 1.00
R5204:Sema5a UTSW 15 32686647 missense probably benign 0.00
R5580:Sema5a UTSW 15 32574885 missense probably benign 0.00
R5937:Sema5a UTSW 15 32574841 missense probably damaging 1.00
R6220:Sema5a UTSW 15 32686729 missense probably damaging 0.99
R6897:Sema5a UTSW 15 32550275 missense probably benign 0.05
R7037:Sema5a UTSW 15 32686847 missense probably damaging 1.00
R7072:Sema5a UTSW 15 32574959 missense possibly damaging 0.94
R7273:Sema5a UTSW 15 32417462 missense probably benign
X0020:Sema5a UTSW 15 32417500 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTACAGGTTGGACATCATGCCC -3'
(R):5'- TCGCTGGAACAGTACCGCATTTC -3'

Sequencing Primer
(F):5'- CTATGAATGTGCTCTCAAGGC -3'
(R):5'- GGAACAGTACCGCATTTCTATCC -3'
Posted On2013-05-09