Incidental Mutation 'R4073:Slc28a3'
ID368323
Institutional Source Beutler Lab
Gene Symbol Slc28a3
Ensembl Gene ENSMUSG00000021553
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 3
SynonymsCnt3
MMRRC Submission 041621-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4073 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location58545399-58610877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58559290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 565 (I565V)
Ref Sequence ENSEMBL: ENSMUSP00000022036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022036] [ENSMUST00000140760]
Predicted Effect probably benign
Transcript: ENSMUST00000022036
AA Change: I565V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000022036
Gene: ENSMUSG00000021553
AA Change: I565V

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 146 163 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Pfam:Nucleos_tra2_N 221 292 3.5e-27 PFAM
Pfam:Gate 300 401 4.9e-11 PFAM
Pfam:Nucleos_tra2_C 403 627 4.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140760
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoside transporters, such as SLC28A3, regulate multiple cellular processes, including neurotransmission, vascular tone, adenosine concentration in the vicinity of cell surface receptors, and transport and metabolism of nucleoside drugs. SLC28A3 shows broad specificity for pyrimidine and purine nucleosides (Ritzel et al., 2001 [PubMed 11032837]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415M13Rik C T 17: 53,724,466 noncoding transcript Het
Alox12 T C 11: 70,247,310 N400D probably damaging Het
Axl A G 7: 25,763,911 probably benign Het
Cbs C T 17: 31,633,005 C8Y possibly damaging Het
Ccdc103 C T 11: 102,884,099 R175W probably damaging Het
Clasp1 T C 1: 118,503,848 F171L probably damaging Het
Cnot10 A G 9: 114,622,947 F254L possibly damaging Het
Cytl1 A G 5: 37,735,596 I17V unknown Het
Dnah11 A G 12: 118,045,678 M2083T probably benign Het
Dock7 A T 4: 99,008,059 S768R probably benign Het
Egf C T 3: 129,735,969 R264Q probably benign Het
Ehhadh T C 16: 21,766,507 D208G probably benign Het
Eqtn A G 4: 94,919,962 I201T possibly damaging Het
Erbin T C 13: 103,860,111 E211G probably damaging Het
Ercc4 G A 16: 13,130,685 V499I probably damaging Het
Gpd2 A G 2: 57,290,013 R91G probably damaging Het
Herc1 A G 9: 66,418,492 D1416G probably benign Het
Ighv1-30 C T 12: 114,817,401 noncoding transcript Het
Il23r A G 6: 67,486,122 I129T probably damaging Het
Jph4 T C 14: 55,115,040 S79G probably benign Het
Lamp3 A G 16: 19,700,716 L239P possibly damaging Het
Lrig3 C T 10: 126,013,408 T999I probably benign Het
Lrrc71 G A 3: 87,745,262 T185I probably benign Het
Mroh1 A G 15: 76,407,985 D219G probably benign Het
Mtor T A 4: 148,549,375 S2342T probably damaging Het
Nf2 T C 11: 4,848,958 S10G probably benign Het
Nlrp4c A G 7: 6,072,710 K667E probably benign Het
Nrm T A 17: 35,861,532 probably benign Het
Nsd1 T A 13: 55,247,728 H1047Q probably benign Het
Obox3 G T 7: 15,625,799 T315N possibly damaging Het
Olfr1274-ps T C 2: 90,400,993 F111L probably benign Het
Olfr1469 G A 19: 13,410,935 R122H possibly damaging Het
Olfr303 T A 7: 86,394,947 I184F probably damaging Het
Olfr328 T C 11: 58,552,062 Y59C probably damaging Het
Olfr729 A G 14: 50,148,043 V277A possibly damaging Het
Olfr885 T C 9: 38,061,869 L183P probably damaging Het
Pbx3 T C 2: 34,224,412 Y112C probably damaging Het
Pde11a C T 2: 76,337,898 R237H probably damaging Het
Phactr1 ACTT A 13: 43,059,769 probably benign Het
Pidd1 A G 7: 141,440,826 F453L probably damaging Het
Ptgs1 C T 2: 36,237,776 R116C probably damaging Het
Rab39b T C X: 75,575,052 probably benign Het
Rpp25 T C 9: 57,504,309 S25P probably benign Het
Rrbp1 T G 2: 143,963,110 Q1045P probably benign Het
Sbk3 G T 7: 4,970,502 A41D probably damaging Het
Slc24a3 T A 2: 145,613,716 probably benign Het
Slc35a3 T C 3: 116,675,238 T275A probably benign Het
Spink12 A G 18: 44,104,664 N3S possibly damaging Het
Srp72 C A 5: 76,998,251 T633K probably benign Het
Tab3 G T X: 85,614,457 V197F probably damaging Het
Taf2 A G 15: 55,052,237 L431P probably damaging Het
Tas2r131 A T 6: 132,957,839 Y2* probably null Het
Tmprss11e T C 5: 86,715,643 T188A possibly damaging Het
Trpv1 T C 11: 73,250,780 V175A probably damaging Het
Usp21 T C 1: 171,282,172 probably benign Het
Vmn1r25 A G 6: 57,978,587 V239A possibly damaging Het
Zbbx C T 3: 75,105,671 G151E probably damaging Het
Zfhx4 G T 3: 5,399,324 C1514F probably damaging Het
Other mutations in Slc28a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc28a3 APN 13 58574300 missense probably benign 0.05
IGL00432:Slc28a3 APN 13 58569411 splice site probably null
IGL00553:Slc28a3 APN 13 58563009 splice site probably null
IGL01725:Slc28a3 APN 13 58578510 missense probably benign 0.30
IGL02068:Slc28a3 APN 13 58558597 missense probably damaging 1.00
IGL02270:Slc28a3 APN 13 58580584 missense probably benign 0.00
IGL02271:Slc28a3 APN 13 58558637 missense probably benign 0.21
IGL02373:Slc28a3 APN 13 58578404 critical splice donor site probably null
IGL02542:Slc28a3 APN 13 58573470 missense probably damaging 1.00
IGL03242:Slc28a3 APN 13 58574249 nonsense probably null
R0256:Slc28a3 UTSW 13 58573500 missense probably benign
R0323:Slc28a3 UTSW 13 58564052 nonsense probably null
R0391:Slc28a3 UTSW 13 58569415 splice site probably benign
R0838:Slc28a3 UTSW 13 58588269 missense probably benign 0.00
R1433:Slc28a3 UTSW 13 58563106 missense probably damaging 1.00
R1437:Slc28a3 UTSW 13 58558575 nonsense probably null
R3499:Slc28a3 UTSW 13 58573439 splice site probably benign
R3822:Slc28a3 UTSW 13 58558278 missense probably benign 0.00
R3948:Slc28a3 UTSW 13 58563010 splice site probably null
R4011:Slc28a3 UTSW 13 58566250 missense probably benign 0.06
R4028:Slc28a3 UTSW 13 58610756 missense probably benign 0.27
R4745:Slc28a3 UTSW 13 58574263 missense possibly damaging 0.69
R4939:Slc28a3 UTSW 13 58558581 missense probably benign 0.44
R5416:Slc28a3 UTSW 13 58576793 missense probably damaging 0.99
R5421:Slc28a3 UTSW 13 58574265 missense possibly damaging 0.87
R5426:Slc28a3 UTSW 13 58563154 missense probably damaging 1.00
R5688:Slc28a3 UTSW 13 58558649 missense probably damaging 0.96
R6066:Slc28a3 UTSW 13 58578487 missense probably benign 0.00
R6790:Slc28a3 UTSW 13 58582650 missense probably benign 0.00
R6919:Slc28a3 UTSW 13 58573443 critical splice donor site probably null
R7009:Slc28a3 UTSW 13 58610804 missense probably benign 0.28
R7102:Slc28a3 UTSW 13 58588214 missense probably benign 0.04
R7305:Slc28a3 UTSW 13 58566231 missense possibly damaging 0.65
R7307:Slc28a3 UTSW 13 58563172 missense probably damaging 1.00
R7464:Slc28a3 UTSW 13 58563021 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGGGATTAAACATGGACCC -3'
(R):5'- CTGTTGTGAAGTGTCCCTTAAATC -3'

Sequencing Primer
(F):5'- ACCCTAGAGGACTTAGCTACTGTTG -3'
(R):5'- GAAGTGTCCCTTAAATCTACATTCC -3'
Posted On2016-01-25