Incidental Mutation 'R4227:Birc6'
ID368330
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Namebaculoviral IAP repeat-containing 6
SynonymsD630005A10Rik, apollon, Bruce, A430032G04Rik, A430040A19Rik
MMRRC Submission 041047-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4227 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74528295-74703356 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 74619840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138270 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182278] [ENSMUST00000182597] [ENSMUST00000182845] [ENSMUST00000182944] [ENSMUST00000183224]
Predicted Effect probably benign
Transcript: ENSMUST00000177957
Predicted Effect probably null
Transcript: ENSMUST00000180037
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181387
Predicted Effect probably null
Transcript: ENSMUST00000182133
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182221
Predicted Effect probably benign
Transcript: ENSMUST00000182278
SMART Domains Protein: ENSMUSP00000138343
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 79 84 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
low complexity region 222 243 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182597
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182845
SMART Domains Protein: ENSMUSP00000138717
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 166 171 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
low complexity region 315 336 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000182944
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000183224
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Meta Mutation Damage Score 0.508 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,284,776 T609A probably damaging Het
Agbl2 T G 2: 90,801,453 L385R probably damaging Het
Arfgef2 A T 2: 166,867,324 D1107V probably damaging Het
Arhgef5 C T 6: 43,279,498 A1180V probably damaging Het
B9d1 C G 11: 61,512,657 R160G probably damaging Het
Capn11 A G 17: 45,642,466 probably null Het
Ceacam12 G T 7: 18,071,753 M288I probably benign Het
Cfhr3 T A 1: 139,608,308 noncoding transcript Het
Copa A G 1: 172,118,115 probably benign Het
Cypt4 A G 9: 24,625,492 M93V probably benign Het
Fat3 G A 9: 16,377,693 T178I probably damaging Het
Gm15931 A G 7: 4,274,794 noncoding transcript Het
Gm9871 A G 6: 101,796,693 noncoding transcript Het
Gpsm1 T C 2: 26,339,626 probably benign Het
Grhl1 A G 12: 24,611,851 T510A probably benign Het
Kcnn3 A C 3: 89,521,175 H236P possibly damaging Het
Kif21b T A 1: 136,154,093 probably null Het
Lcn3 G T 2: 25,766,111 M59I probably benign Het
Mrps27 C G 13: 99,411,340 P253A probably damaging Het
Mug2 A T 6: 122,040,732 D476V probably benign Het
Naca A T 10: 128,041,661 probably benign Het
Naip5 A G 13: 100,212,768 S1351P probably damaging Het
Odf2 A G 2: 29,901,284 probably benign Het
Olfr1143 T A 2: 87,802,875 I162N probably damaging Het
Olfr1284 A G 2: 111,379,065 K22E probably benign Het
Olfr444 A G 6: 42,955,714 Y72C possibly damaging Het
Olfr598 A T 7: 103,328,819 H111L probably damaging Het
P3h2 G T 16: 26,105,453 D77E probably benign Het
Pcbp2 A G 15: 102,478,631 M87V probably benign Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhh2 A G 17: 84,566,795 T503A probably benign Het
Pnpla3 C A 15: 84,179,190 N256K probably benign Het
Polh A G 17: 46,172,594 S582P probably benign Het
Ptprb T C 10: 116,302,225 Y345H possibly damaging Het
Rasl11b T A 5: 74,198,191 I119N probably damaging Het
Rnaseh2a G A 8: 84,960,073 T149I possibly damaging Het
Serpina10 A G 12: 103,628,415 Y182H probably damaging Het
Serpina1d A G 12: 103,767,481 V188A probably benign Het
Setd1a C A 7: 127,796,647 probably benign Het
Slc17a8 T C 10: 89,598,713 N184S probably damaging Het
Spen C T 4: 141,522,147 S110N unknown Het
Tas1r1 T C 4: 152,028,272 I775V probably damaging Het
Tktl2 A G 8: 66,513,699 probably null Het
Tmem181a T A 17: 6,295,786 L185H probably damaging Het
Tmprss6 C T 15: 78,446,699 V43M probably damaging Het
Try5 A G 6: 41,313,467 Y28H possibly damaging Het
Urad A T 5: 147,315,290 F117L probably damaging Het
Vegfc A G 8: 54,159,410 Y156C probably damaging Het
Vmn2r45 A T 7: 8,483,278 V337E probably damaging Het
Vmn2r6 A T 3: 64,537,948 F696L probably damaging Het
Wnk2 C T 13: 49,090,837 D508N probably damaging Het
Zfp131 T C 13: 119,766,746 D455G probably damaging Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74573563 splice site probably benign
IGL00542:Birc6 APN 17 74623771 unclassified probably null
IGL00659:Birc6 APN 17 74660653 missense probably damaging 1.00
IGL00710:Birc6 APN 17 74609089 missense probably benign 0.37
IGL00806:Birc6 APN 17 74611529 missense possibly damaging 0.85
IGL00848:Birc6 APN 17 74696393 nonsense probably null
IGL01071:Birc6 APN 17 74566132 missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74631701 missense probably damaging 1.00
IGL01121:Birc6 APN 17 74631038 missense probably benign 0.08
IGL01132:Birc6 APN 17 74603060 missense probably damaging 1.00
IGL01323:Birc6 APN 17 74622925 missense probably damaging 1.00
IGL01444:Birc6 APN 17 74631687 missense probably damaging 1.00
IGL01511:Birc6 APN 17 74627003 nonsense probably null
IGL01576:Birc6 APN 17 74677370 missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74648197 missense probably benign 0.08
IGL01649:Birc6 APN 17 74604546 missense probably benign 0.03
IGL01657:Birc6 APN 17 74660611 missense probably damaging 1.00
IGL01739:Birc6 APN 17 74659221 missense probably benign
IGL01756:Birc6 APN 17 74640208 missense probably benign 0.00
IGL01807:Birc6 APN 17 74631037 missense probably benign
IGL01885:Birc6 APN 17 74604516 missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74638358 missense probably damaging 1.00
IGL01915:Birc6 APN 17 74631720 missense probably benign 0.34
IGL01998:Birc6 APN 17 74579885 missense probably benign 0.06
IGL02084:Birc6 APN 17 74608282 missense probably benign 0.45
IGL02086:Birc6 APN 17 74639827 missense probably damaging 1.00
IGL02161:Birc6 APN 17 74548837 missense probably damaging 0.99
IGL02195:Birc6 APN 17 74697381 splice site probably benign
IGL02283:Birc6 APN 17 74599940 missense probably benign
IGL02476:Birc6 APN 17 74696391 missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74652059 unclassified probably benign
IGL02547:Birc6 APN 17 74579645 missense probably benign 0.21
IGL02678:Birc6 APN 17 74649903 missense probably damaging 1.00
IGL02713:Birc6 APN 17 74579324 missense probably benign
IGL02851:Birc6 APN 17 74609189 missense probably damaging 1.00
IGL02875:Birc6 APN 17 74589718 missense probably damaging 1.00
IGL02985:Birc6 APN 17 74640190 missense probably benign 0.00
IGL03004:Birc6 APN 17 74612185 missense probably benign 0.10
IGL03053:Birc6 APN 17 74565972 missense probably damaging 1.00
IGL03085:Birc6 APN 17 74596950 missense probably damaging 0.97
IGL03109:Birc6 APN 17 74579334 missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74598999 missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74659231 missense probably benign
IGL03221:Birc6 APN 17 74627007 missense probably benign 0.00
IGL03230:Birc6 APN 17 74611070 missense probably damaging 1.00
IGL03294:Birc6 APN 17 74649886 missense probably benign 0.02
IGL03399:Birc6 APN 17 74594373 missense probably benign 0.01
Badlands UTSW 17 74603036 missense probably damaging 1.00
Black_hills UTSW 17 74692332 missense probably damaging 1.00
bottomlands UTSW 17 74609659 missense probably damaging 1.00
Sempervirens UTSW 17 74642504 missense probably damaging 1.00
E0370:Birc6 UTSW 17 74677357 missense probably damaging 1.00
PIT4494001:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R0081:Birc6 UTSW 17 74643441 missense probably benign 0.01
R0086:Birc6 UTSW 17 74593166 missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74638376 missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74623746 splice site probably benign
R0129:Birc6 UTSW 17 74528760 missense probably benign 0.05
R0196:Birc6 UTSW 17 74580287 missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74609327 missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74662832 splice site probably benign
R0295:Birc6 UTSW 17 74613362 intron probably benign
R0386:Birc6 UTSW 17 74599340 missense probably damaging 0.99
R0423:Birc6 UTSW 17 74696297 missense probably damaging 1.00
R0449:Birc6 UTSW 17 74692295 missense probably damaging 1.00
R0453:Birc6 UTSW 17 74649754 missense probably damaging 1.00
R0457:Birc6 UTSW 17 74652028 missense probably benign
R0457:Birc6 UTSW 17 74662625 missense probably damaging 1.00
R0564:Birc6 UTSW 17 74625243 splice site probably benign
R0575:Birc6 UTSW 17 74689237 missense probably damaging 1.00
R0582:Birc6 UTSW 17 74643337 missense probably damaging 1.00
R0624:Birc6 UTSW 17 74580349 missense probably benign 0.20
R0973:Birc6 UTSW 17 74565861 missense probably damaging 0.99
R1061:Birc6 UTSW 17 74689312 missense probably damaging 1.00
R1378:Birc6 UTSW 17 74660455 missense probably damaging 1.00
R1402:Birc6 UTSW 17 74697533 splice site probably benign
R1436:Birc6 UTSW 17 74652705 missense probably damaging 1.00
R1456:Birc6 UTSW 17 74609290 missense probably benign 0.35
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1474:Birc6 UTSW 17 74579678 missense probably damaging 0.98
R1479:Birc6 UTSW 17 74634853 missense probably damaging 1.00
R1486:Birc6 UTSW 17 74639820 missense probably damaging 1.00
R1499:Birc6 UTSW 17 74612319 missense probably damaging 1.00
R1515:Birc6 UTSW 17 74528636 nonsense probably null
R1549:Birc6 UTSW 17 74662742 missense probably damaging 1.00
R1559:Birc6 UTSW 17 74692237 missense probably damaging 1.00
R1573:Birc6 UTSW 17 74660690 splice site probably benign
R1615:Birc6 UTSW 17 74609409 intron probably null
R1621:Birc6 UTSW 17 74670250 missense probably benign
R1680:Birc6 UTSW 17 74548746 missense probably benign 0.01
R1743:Birc6 UTSW 17 74579756 missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74640013 missense probably damaging 1.00
R1775:Birc6 UTSW 17 74612286 missense probably damaging 1.00
R1818:Birc6 UTSW 17 74649849 missense probably damaging 1.00
R1836:Birc6 UTSW 17 74614390 missense probably benign 0.41
R1931:Birc6 UTSW 17 74565982 missense probably damaging 0.99
R1939:Birc6 UTSW 17 74670337 missense probably damaging 1.00
R1964:Birc6 UTSW 17 74634885 missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74598062 missense probably benign 0.01
R2000:Birc6 UTSW 17 74604619 missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74609659 missense probably damaging 1.00
R2090:Birc6 UTSW 17 74662796 missense probably benign
R2130:Birc6 UTSW 17 74659154 splice site probably benign
R2144:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74635795 missense probably benign 0.02
R2180:Birc6 UTSW 17 74612151 missense probably benign 0.03
R2271:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2272:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2416:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2421:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2422:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2513:Birc6 UTSW 17 74647729 missense probably damaging 0.97
R2912:Birc6 UTSW 17 74692206 missense probably damaging 1.00
R3024:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74618429 splice site probably benign
R3772:Birc6 UTSW 17 74618429 splice site probably benign
R3829:Birc6 UTSW 17 74655178 missense probably damaging 1.00
R3913:Birc6 UTSW 17 74573613 nonsense probably null
R3915:Birc6 UTSW 17 74579608 missense probably benign 0.12
R3921:Birc6 UTSW 17 74627019 missense probably damaging 0.98
R3928:Birc6 UTSW 17 74611175 missense possibly damaging 0.91
R3928:Birc6 UTSW 17 74638409 missense probably damaging 1.00
R4111:Birc6 UTSW 17 74566015 missense probably damaging 1.00
R4155:Birc6 UTSW 17 74596939 missense probably benign 0.00
R4163:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R4226:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4358:Birc6 UTSW 17 74619668 intron probably null
R4524:Birc6 UTSW 17 74641777 missense probably damaging 1.00
R4605:Birc6 UTSW 17 74639934 missense probably damaging 1.00
R4619:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4620:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4762:Birc6 UTSW 17 74629489 missense probably damaging 1.00
R4814:Birc6 UTSW 17 74649672 missense probably damaging 1.00
R4849:Birc6 UTSW 17 74647388 missense probably damaging 0.99
R4869:Birc6 UTSW 17 74586012 missense probably benign 0.05
R4912:Birc6 UTSW 17 74565905 missense probably damaging 1.00
R4921:Birc6 UTSW 17 74650099 missense probably damaging 1.00
R4942:Birc6 UTSW 17 74623050 missense probably damaging 1.00
R4954:Birc6 UTSW 17 74612031 missense probably damaging 1.00
R4992:Birc6 UTSW 17 74689256 missense probably benign 0.44
R4994:Birc6 UTSW 17 74594324 intron probably benign
R5018:Birc6 UTSW 17 74640059 missense probably damaging 1.00
R5022:Birc6 UTSW 17 74692332 missense probably damaging 1.00
R5054:Birc6 UTSW 17 74655325 missense probably damaging 1.00
R5068:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5069:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5070:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5196:Birc6 UTSW 17 74606141 splice site probably benign
R5209:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5212:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5216:Birc6 UTSW 17 74613470 missense probably damaging 1.00
R5279:Birc6 UTSW 17 74650047 missense probably damaging 0.98
R5286:Birc6 UTSW 17 74670247 missense probably damaging 1.00
R5399:Birc6 UTSW 17 74604578 missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74641782 missense possibly damaging 0.86
R5482:Birc6 UTSW 17 74662690 missense probably damaging 1.00
R5492:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5504:Birc6 UTSW 17 74655213 missense probably damaging 1.00
R5519:Birc6 UTSW 17 74580178 missense probably benign
R5544:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5608:Birc6 UTSW 17 74613544 missense probably damaging 0.99
R5623:Birc6 UTSW 17 74528656 missense probably damaging 0.99
R5701:Birc6 UTSW 17 74697425 missense possibly damaging 0.59
R5707:Birc6 UTSW 17 74696404 missense probably damaging 1.00
R5715:Birc6 UTSW 17 74631620 missense probably damaging 1.00
R5734:Birc6 UTSW 17 74618424 splice site probably benign
R5792:Birc6 UTSW 17 74631053 missense probably benign 0.05
R5809:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5810:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5813:Birc6 UTSW 17 74646502 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599237 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599238 missense probably damaging 0.98
R5960:Birc6 UTSW 17 74528765 missense probably damaging 0.97
R5961:Birc6 UTSW 17 74646601 missense probably damaging 1.00
R5967:Birc6 UTSW 17 74660439 missense probably damaging 0.99
R5970:Birc6 UTSW 17 74618502 missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74603036 missense probably damaging 1.00
R5982:Birc6 UTSW 17 74648158 missense probably benign
R6023:Birc6 UTSW 17 74654377 missense probably benign 0.24
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6243:Birc6 UTSW 17 74609387 missense probably damaging 0.96
R6294:Birc6 UTSW 17 74689257 missense probably benign 0.00
R6327:Birc6 UTSW 17 74662779 missense probably damaging 1.00
R6501:Birc6 UTSW 17 74579281 missense probably damaging 1.00
R6810:Birc6 UTSW 17 74612220 missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74580382 missense possibly damaging 0.82
R6822:Birc6 UTSW 17 74598044 missense probably damaging 1.00
R6835:Birc6 UTSW 17 74642504 missense probably damaging 1.00
R6945:Birc6 UTSW 17 74579531 missense probably benign 0.04
R6957:Birc6 UTSW 17 74579491 missense probably benign
R6989:Birc6 UTSW 17 74630989 missense probably benign 0.18
R6991:Birc6 UTSW 17 74562095 missense probably damaging 1.00
R7019:Birc6 UTSW 17 74609345 missense probably benign 0.01
R7092:Birc6 UTSW 17 74646745 missense probably damaging 1.00
R7158:Birc6 UTSW 17 74594376 missense probably benign 0.25
R7204:Birc6 UTSW 17 74640108 missense probably damaging 1.00
R7267:Birc6 UTSW 17 74585985 missense probably benign 0.00
R7316:Birc6 UTSW 17 74604494 missense probably damaging 0.99
Z1088:Birc6 UTSW 17 74611542 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACATCAGTCCTTTGCTGTGTAG -3'
(R):5'- TTTCCTGGCTCAGAACCCAC -3'

Sequencing Primer
(F):5'- TTGCCTGAATAATGAGCAGCTG -3'
(R):5'- GAACCCACTCTGAAGGTTGTTTACG -3'
Posted On2016-01-27