Incidental Mutation 'R4231:Mta1'
ID368331
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Namemetastasis associated 1
Synonyms
MMRRC Submission 041050-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4231 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location113098278-113137206 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113135827 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 603 (M603T)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000084882] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727] [ENSMUST00000200380]
Predicted Effect probably benign
Transcript: ENSMUST00000009099
AA Change: M615T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: M615T

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069690
AA Change: M598T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: M598T

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084882
SMART Domains Protein: ENSMUSP00000081943
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 4 56 2.08e-12 SMART
low complexity region 104 115 N/A INTRINSIC
LIM 125 177 6.05e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109723
AA Change: M603T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: M603T

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109726
AA Change: M598T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: M598T

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109727
AA Change: M603T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: M603T

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156030
Predicted Effect probably benign
Transcript: ENSMUST00000200380
SMART Domains Protein: ENSMUSP00000143334
Gene: ENSMUSG00000006356

DomainStartEndE-ValueType
LIM 1 53 3e-16 SMART
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
4932438A13Rik C T 3: 36,920,236 T663I probably benign Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 A T 12: 53,141,038 D1745V probably damaging Het
Aldh5a1 C T 13: 24,911,653 G494R probably damaging Het
Ankar T C 1: 72,658,542 D1034G probably benign Het
Aox3 T A 1: 58,114,885 N23K probably benign Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Cacnb2 A G 2: 14,981,440 K343E probably damaging Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Cd93 A T 2: 148,442,960 H155Q probably benign Het
Cox6b2 T C 7: 4,752,835 M1V probably null Het
Crat T C 2: 30,413,011 E88G possibly damaging Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dip2a G A 10: 76,319,470 P94S probably damaging Het
Dtx3 A G 10: 127,193,189 I60T possibly damaging Het
Fam196b A T 11: 34,403,143 E395V probably benign Het
Filip1l T C 16: 57,506,768 S54P probably benign Het
Gm12887 A T 4: 121,622,102 M1K probably null Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Irak2 A G 6: 113,690,856 E466G probably damaging Het
Irgm2 C T 11: 58,219,478 probably benign Het
Jak3 T A 8: 71,685,545 V880D probably damaging Het
Jmy G T 13: 93,498,925 P128T probably benign Het
Kif20a A G 18: 34,632,038 N775S probably benign Het
Kremen1 G A 11: 5,243,881 Q50* probably null Het
Lrrc71 A G 3: 87,740,991 I438T probably benign Het
Map3k1 T C 13: 111,768,494 T374A probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Myo5a A G 9: 75,189,997 N1319S possibly damaging Het
Nalcn T A 14: 123,599,913 Q13L probably benign Het
Nbas A G 12: 13,393,343 N1133S probably damaging Het
Nsun2 A G 13: 69,619,541 N205D probably damaging Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr1293-ps C T 2: 111,528,201 R314C probably damaging Het
Olfr53 T C 7: 140,652,740 Y254H probably damaging Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A G 1: 97,884,124 probably null Het
Pcdh7 G A 5: 57,719,289 G62D possibly damaging Het
Plxna2 C T 1: 194,644,454 T232I probably damaging Het
Prkar1b A G 5: 139,108,621 S71P probably damaging Het
Ptprq A T 10: 107,686,283 Y602* probably null Het
Rfx4 A T 10: 84,814,694 M84L probably benign Het
Rfx7 A T 9: 72,619,390 E1287D possibly damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf216 A T 5: 143,093,090 S35T probably damaging Het
Rps6kc1 A G 1: 190,808,900 V402A probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sart3 A G 5: 113,771,418 M73T probably benign Het
Scn10a G T 9: 119,631,544 T1088K probably damaging Het
Senp2 T C 16: 22,011,554 probably null Het
Setd7 T C 3: 51,542,730 N92D probably benign Het
Sipa1 A T 19: 5,654,089 L735Q probably damaging Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slitrk6 A T 14: 110,751,388 S296T probably benign Het
Spc24 T C 9: 21,756,202 probably null Het
Tex15 T C 8: 33,572,137 S806P probably damaging Het
Tgm3 A T 2: 130,044,589 K577* probably null Het
Wscd2 A G 5: 113,560,984 D200G probably benign Het
Xpo6 T C 7: 126,174,182 T24A possibly damaging Het
Zfhx2 A G 14: 55,073,534 C568R possibly damaging Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2110:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 intron probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGAGGACATCTTACAGGCAGG -3'
(R):5'- AACACCTTGAGGGATGTGTG -3'

Sequencing Primer
(F):5'- ATCTTACAGGCAGGCCCCTTG -3'
(R):5'- CCTTGAGGGATGTGTGCGAAC -3'
Posted On2016-01-28